Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006715.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

4197 .. 6033

Gene Structure 1837 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 618 bp

atggaatctgcatttcttgagccttggtttttcgaaaattttatagactcatcttttgaccaacctgatttcatcaacatggatgatactccaattgatagcccagacttctcttctctgttcaactcaaatgaagttttcaaaatttcggaaattgcatcagacccttttgccaccctgtttcctggtgatgatctgattcaagtgacatcccaagtggaggaagtttcaatggatttggaagcatatgagactaatttgatgatagagcgtttctatggtaattcattggaagggagtgaagggagttttccatcacagcaagcttcttcacaccaattttctgctgaaggaaatgatgtgtggagtccaaattcaatagcgtgtaggattgtaggagtgctatcctggttcggggattgcaaacaatctttcaatccctgctgtgtgaccgatataggtatggccgagggctgcagggagggggcagcaggggctgctgtgcaaggttgcaaacgcacgggcgcgcgggctgcagcgaaggctcgactagctcgggctaggggctgctttgtgaatgagttttggttttctgttttgtggttagagtcgtgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GRAS

Protein Analysis

205

Amino Acids

22.61

Weight (kDa)

4.13

Isoelectric Point (pI)

36.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	527, 529
AciI	CCGC	1 cut(s)	529
AcoI	YGGCCR	1 cut(s)	465
AcsI	RAATTY	3 cut(s)	37, 144, 373
AcuI	CTGAAG	1 cut(s)	369
AfiI	CCNNNNNNNGG	2 cut(s)	220, 414
AgsI	TTSAA	6 cut(s)	124, 142, 203, 231, 378, 436
AjnI	CCWGG	2 cut(s)	184, 407
AluBI	AGCT	2 cut(s)	326, 554
AluI	AGCT	2 cut(s)	326, 554
Alw26I	GTCTC	1 cut(s)	245
AlwNI	CAGNNNCTG	1 cut(s)	497
Ama87I	CYCGRG	1 cut(s)	555
AoxI	GGCC	1 cut(s)	465
ApeKI	GCWGC	6 cut(s)	474, 488, 497, 533, 536, 567
ApoI	RAATTY	3 cut(s)	37, 144, 373
ArsI	GACNNNNNNTTYG	2 cut(s)	38, 70
AspLEI	GCGC	2 cut(s)	527, 529
AsuHPI	GGTGA	1 cut(s)	200
AsuII	TTCGAA	1 cut(s)	33
AvaI	CYCGRG	1 cut(s)	555
BbvI	GCAGC	6 cut(s)	461, 484, 500, 520, 548, 554
BccI	CCATC	1 cut(s)	322
BciT130I	CCWGG	2 cut(s)	186, 409
BcoDI	GTCTC	1 cut(s)	245
BfaI	CTAG	2 cut(s)	551, 561
BfmI	CTRYAG	2 cut(s)	475, 534
BisI	GCNGC	6 cut(s)	475, 489, 498, 534, 537, 568
BlsI	GCNGC	6 cut(s)	476, 490, 499, 535, 538, 569
Bme1390I	CCNGG	2 cut(s)	186, 409
BmeT110I	CYCGRG	1 cut(s)	555
BmrFI	CCNGG	2 cut(s)	186, 409
BmsI	GCATC	1 cut(s)	167
Bpu14I	TTCGAA	1 cut(s)	33
BpuEI	CTTGAG	1 cut(s)	38
BsaJI	CCNNGG	2 cut(s)	23, 468
Bsc4I	CCNNNNNNNGG	2 cut(s)	220, 414
BseBI	CCWGG	2 cut(s)	186, 409
BseDI	CCNNGG	2 cut(s)	23, 468
BseGI	GGATG	2 cut(s)	88, 209
BseLI	CCNNNNNNNGG	2 cut(s)	220, 414
BsePI	GCGCGC	1 cut(s)	525
BseXI	GCAGC	6 cut(s)	461, 484, 500, 520, 548, 554
Bsh1236I	CGCG	2 cut(s)	527, 529
BshFI	GGCC	1 cut(s)	467
BsiHKCI	CYCGRG	1 cut(s)	555
BslI	CCNNNNNNNGG	2 cut(s)	220, 414
BsmAI	GTCTC	1 cut(s)	245
BsnI	GGCC	1 cut(s)	467
BsoBI	CYCGRG	1 cut(s)	555
Bsp119I	TTCGAA	1 cut(s)	33
Bsp143I	GATC	1 cut(s)	193
BspACI	CCGC	1 cut(s)	529
BspANI	GGCC	1 cut(s)	467
BspFNI	CGCG	2 cut(s)	527, 529
BspMAI	CTGCAG	2 cut(s)	479, 538
BspT104I	TTCGAA	1 cut(s)	33
BssECI	CCNNGG	2 cut(s)	23, 468
BssHII	GCGCGC	1 cut(s)	525
BssMI	GATC	1 cut(s)	193
BssT1I	CCWWGG	1 cut(s)	23
Bst2UI	CCWGG	2 cut(s)	186, 409
Bst6I	CTCTTC	1 cut(s)	118
BstAPI	GCANNNNNTGC	1 cut(s)	497
BstBI	TTCGAA	1 cut(s)	33
BstC8I	GCNNGC	3 cut(s)	324, 527, 531
BstF5I	GGATG	2 cut(s)	88, 209
BstFNI	CGCG	2 cut(s)	527, 529
BstHHI	GCGC	2 cut(s)	527, 529
BstKTI	GATC	1 cut(s)	196
BstMAI	GTCTC	1 cut(s)	245
BstMBI	GATC	1 cut(s)	193
BstMWI	GCNNNNNNNGC	5 cut(s)	494, 497, 533, 542, 551
BstNI	CCWGG	2 cut(s)	186, 409
BstSCI	CCNGG	2 cut(s)	184, 407
BstSFI	CTRYAG	2 cut(s)	475, 534
BstUI	CGCG	2 cut(s)	527, 529
BstV1I	GCAGC	6 cut(s)	461, 484, 500, 520, 548, 554
BsuRI	GGCC	1 cut(s)	467
BtsCI	GGATG	2 cut(s)	88, 209
Cac8I	GCNNGC	3 cut(s)	324, 527, 531
CaiI	CAGNNNCTG	1 cut(s)	497
CfoI	GCGC	2 cut(s)	527, 529
CviAII	CATG	1 cut(s)	79
DpnI	GATC	1 cut(s)	195
DpnII	GATC	1 cut(s)	193
EaeI	YGGCCR	1 cut(s)	465
Eam1104I	CTCTTC	1 cut(s)	118
EarI	CTCTTC	1 cut(s)	118
Eco130I	CCWWGG	1 cut(s)	23
Eco57I	CTGAAG	1 cut(s)	369
Eco88I	CYCGRG	1 cut(s)	555
EcoRII	CCWGG	2 cut(s)	184, 407
EcoT14I	CCWWGG	1 cut(s)	23
ErhI	CCWWGG	1 cut(s)	23
FaeI	CATG	1 cut(s)	82
FaiI	YATR	7 cut(s)	44, 80, 247, 249, 279, 458, 464
FatI	CATG	1 cut(s)	78
FauI	CCCGC	1 cut(s)	522
FauNDI	CATATG	1 cut(s)	247
Fnu4HI	GCNGC	6 cut(s)	475, 489, 498, 534, 537, 568
FokI	GGATG	2 cut(s)	95, 196
Fsp4HI	GCNGC	6 cut(s)	475, 489, 498, 534, 537, 568
FspBI	CTAG	2 cut(s)	551, 561
GlaI	GCGC	2 cut(s)	526, 528
GluI	GCNGC	6 cut(s)	475, 489, 498, 534, 537, 568
HaeIII	GGCC	1 cut(s)	467
HhaI	GCGC	2 cut(s)	527, 529
Hin1II	CATG	1 cut(s)	82
Hin6I	GCGC	2 cut(s)	525, 527
HinP1I	GCGC	2 cut(s)	525, 527
HindIII	AAGCTT	1 cut(s)	324
HinfI	GANTC	5 cut(s)	5, 47, 199, 367, 608
HphI	GGTGA	1 cut(s)	200
Hpy188I	TCNGA	3 cut(s)	151, 163, 198
Hpy188III	TCNNGA	1 cut(s)	17
HpyAV	CCTTC	4 cut(s)	287, 296, 344, 535
HpyCH4V	TGCA	7 cut(s)	11, 158, 423, 477, 505, 513, 536
HpyF10VI	GCNNNNNNNGC	5 cut(s)	494, 497, 533, 542, 551
Hsp92II	CATG	1 cut(s)	82
HspAI	GCGC	2 cut(s)	525, 527
Kzo9I	GATC	1 cut(s)	193
Lsp1109I	GCAGC	6 cut(s)	461, 484, 500, 520, 548, 554
LweI	GCATC	1 cut(s)	167
MaeI	CTAG	2 cut(s)	551, 561
MaeIII	GTNAC	2 cut(s)	205, 448
MalI	GATC	1 cut(s)	195
MboI	GATC	1 cut(s)	193
MboII	GAAGA	2 cut(s)	105, 321
MfeI	CAATTG	1 cut(s)	93
MluCI	AATT	8 cut(s)	37, 93, 144, 153, 256, 283, 338, 373
MlyI	GAGTC	3 cut(s)	41, 376, 617
MnlI	CCTC	3 cut(s)	214, 463, 475
MslI	CAYNNNNRTG	1 cut(s)	77
MspR9I	CCNGG	2 cut(s)	186, 409
MunI	CAATTG	1 cut(s)	93
MvaI	CCWGG	2 cut(s)	186, 409
MvnI	CGCG	2 cut(s)	527, 529
MwoI	GCNNNNNNNGC	5 cut(s)	494, 497, 533, 542, 551
NdeI	CATATG	1 cut(s)	247
NdeII	GATC	1 cut(s)	193
NlaIII	CATG	1 cut(s)	82
NmeAIII	GCCGAG	1 cut(s)	493
NmuCI	GTSAC	2 cut(s)	205, 448
NspV	TTCGAA	1 cut(s)	33
PauI	GCGCGC	1 cut(s)	525
PfeI	GAWTC	2 cut(s)	5, 199
PkrI	GCNGC	6 cut(s)	476, 490, 499, 535, 538, 569
PleI	GAGTC	3 cut(s)	41, 375, 616
PpsI	GAGTC	3 cut(s)	41, 375, 616
Psp6I	CCWGG	2 cut(s)	184, 407
PspGI	CCWGG	2 cut(s)	184, 407
PstI	CTGCAG	2 cut(s)	479, 538
PstNI	CAGNNNCTG	1 cut(s)	497
PteI	GCGCGC	1 cut(s)	525
RseI	CAYNNNNRTG	1 cut(s)	77
SatI	GCNGC	6 cut(s)	475, 489, 498, 534, 537, 568
Sau3AI	GATC	1 cut(s)	193
SchI	GAGTC	3 cut(s)	41, 376, 617
ScrFI	CCNGG	2 cut(s)	186, 409
SetI	ASST	5 cut(s)	67, 328, 463, 511, 556
SfaNI	GCATC	1 cut(s)	167
SfcI	CTRYAG	2 cut(s)	475, 534
SfuI	TTCGAA	1 cut(s)	33
SmiMI	CAYNNNNRTG	1 cut(s)	77
SmlI	CTYRAG	1 cut(s)	17
SmoI	CTYRAG	1 cut(s)	17
Sse9I	AATT	8 cut(s)	37, 93, 144, 153, 256, 283, 338, 373
SsiI	CCGC	1 cut(s)	529
SspMI	CTAG	2 cut(s)	551, 561
StyD4I	CCNGG	2 cut(s)	184, 407
StyI	CCWWGG	1 cut(s)	23
TaqI	TCGA	2 cut(s)	33, 547
TaqII	GACCGA	1 cut(s)	467
TasI	AATT	8 cut(s)	37, 93, 144, 153, 256, 283, 338, 373
TfiI	GAWTC	2 cut(s)	5, 199
TseFI	GTSAC	2 cut(s)	205, 448
TseI	GCWGC	6 cut(s)	474, 488, 497, 533, 536, 567
Tsp45I	GTSAC	2 cut(s)	205, 448
TspDTI	ATGAA	3 cut(s)	61, 147, 276
XapI	RAATTY	3 cut(s)	37, 144, 373
XspI	CTAG	2 cut(s)	551, 561

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.