Rmu_sc0006783.1_g000006

2-methylene-furan-3-one reductase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006783.1
N/A
Physical Location & Seq
Forward (+)
23081 .. 25589
2509 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1287 bp
atggctgcagctccaagtgagtacataccctctgtatatggggcttgggtctattcagagtatggaaaaactgcaaatgttctgaaatttgatccaaatgtggctgttcctgaaattaaagaggaccaggtgctgatcaaggtggttgctgcttctcttaacccacttgattccagaagggctcttggtctctacaaggacatagagggtgatactaccttacctacaattccagggtatgatgtggctggtgtggtggtgaaggtaggaagccaagtgcagaagtttaaagtgggggatgaagtgtatgcttgtttgagtaatagcaatgagattccccaatatcatgctaagaatagccatggggatctcaatgagaaagcattggtgaaaccaaacaggctggggtctttggcagagtacactgctgcaggagaaaccatgttggctctcaaacccaaaaatctgagctttattgaagctgctagccttcccttagctattgagactgcgtatggagcgcttgaaagaacagagctttcggctggtaaatcctttcacaaacccaaaaatctgagctttattgaagctgctggccttcccttagctattgagactgcgtatggagcgcttgaaagaacggagctttcggctggtaaatccgtccttgttttgggaggctctgggggtgttggaacacatgtgattcagctagctaaacatgtttttggggcatccaaagtagcagctactgcaagcactaaaaaactggatttgttaagaagcttgggtgcggatttggctattgattacaccaaggaaaacatcgaagacctgccagagaaatttgatgtagtctatgatgcagttgggcagactgacaaggcagtgaaggcggtgaaggaaggtgggaaggtagtgacaatagtcataggtccagtaactcctccggcgttcagatttgtgctcacccctacagggtctatcttggagaaactgaagccttacttggagagcgggaagactgacaaggcagtgaaggcggtgaaggaaggtgggaaggtagtgacaatagtcataggtccagtaactcctccggcgttcagatttgtgctcacccctacagggtctatcttggagaaactgaagccttacttggagagcgggaaggtgaagccagtacttgatcccacaggtccatatcccttttctaaagttgttgaagcacttggttaccgtgagacttctagagctacaggaaaggtggttgtgtaccctatcccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ADH_N ADH_zinc_N ADH_zinc_N_2

Protein Analysis

428

Amino Acids

45.46

Weight (kDa)

8.69

Isoelectric Point (pI)

25.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ADH_N PF08240 41 - 153 3e-16 Alcohol dehydrogenase GroES-like domain
ADH_zinc_N PF00107 230 - 312 6.6e-15 Zinc-binding dehydrogenase
ADH_zinc_N_2 PF13602 263 - 424 2.4e-18 Zinc-binding dehydrogenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 843
AccBSI CCGCTC 2 cut(s) 1017, 1164
AciI CCGC 5 cut(s) 794, 896, 1017, 1043, 1164
AclWI GGATC 3 cut(s) 86, 375, 1181
AcsI RAATTY 2 cut(s) 86, 845
AcuI CTGAAG 2 cut(s) 1019, 1166
AfaI GTAC 4 cut(s) 23, 422, 1182, 1274
AfeI AGCGCT 2 cut(s) 522, 630
AfiI CCNNNNNNNGG 3 cut(s) 673, 978, 1125
AflIII ACRYGT 2 cut(s) 700, 721
AgsI TTSAA 5 cut(s) 479, 527, 587, 635, 1223
AjnI CCWGG 2 cut(s) 126, 232
AjuI GAANNNNNNNTTGG 4 cut(s) 992, 1024, 1139, 1171
Alw21I GWGCWC 2 cut(s) 969, 1116
Alw26I GTCTC 4 cut(s) 194, 500, 608, 1235
AlwI GGATC 3 cut(s) 86, 375, 1181
AlwNI CAGNNNCTG 2 cut(s) 133, 752
Aor51HI AGCGCT 2 cut(s) 522, 630
AoxI GGCC 1 cut(s) 595
ApeKI GCWGC 7 cut(s) 5, 8, 149, 428, 482, 590, 746
ApoI RAATTY 2 cut(s) 86, 845
AspLEI GCGC 2 cut(s) 523, 631
AspS9I GGNCC 4 cut(s) 124, 935, 1082, 1196
AsuHPI GGTGA 8 cut(s) 221, 271, 400, 910, 961, 1057, 1108, 1183
AsuNHI GCTAGC 2 cut(s) 485, 712
AvaII GGWCC 4 cut(s) 124, 935, 1082, 1196
BanII GRGCYC 1 cut(s) 184
BbsI GAAGAC 2 cut(s) 837, 1028
Bbv12I GWGCWC 2 cut(s) 969, 1116
BbvI GCAGC 6 cut(s) 20, 136, 415, 469, 577, 758
BciT130I CCWGG 2 cut(s) 128, 234
BclI TGATCA 1 cut(s) 135
BcoDI GTCTC 4 cut(s) 194, 500, 608, 1235
BfaI CTAG 3 cut(s) 486, 713, 1248
BfmI CTRYAG 5 cut(s) 6, 429, 975, 1122, 1254
BfoI RGCGCY 2 cut(s) 524, 632
BfuAI ACCTGC 1 cut(s) 843
BisI GCNGC 7 cut(s) 6, 9, 150, 429, 483, 591, 747
BlsI GCNGC 7 cut(s) 7, 10, 151, 430, 484, 592, 748
BmcAI AGTACT 1 cut(s) 1182
Bme1390I CCNGG 2 cut(s) 128, 234
Bme18I GGWCC 4 cut(s) 124, 935, 1082, 1196
BmgT120I GGNCC 4 cut(s) 124, 935, 1082, 1196
BmrFI CCNGG 2 cut(s) 128, 234
BmsI GCATC 2 cut(s) 743, 853
BmtI GCTAGC 2 cut(s) 489, 716
BoxI GACNNNNGTC 2 cut(s) 926, 1073
BpiI GAAGAC 2 cut(s) 837, 1028
Bpu10I CCTNAGC 2 cut(s) 496, 604
BsaI GGTCTC 1 cut(s) 194
BsaJI CCNNGG 3 cut(s) 233, 361, 816
Bsc4I CCNNNNNNNGG 3 cut(s) 673, 978, 1125
Bse1I ACTGG 4 cut(s) 774, 938, 1085, 1178
Bse3DI GCAATG 1 cut(s) 334
BseBI CCWGG 2 cut(s) 128, 234
BseDI CCNNGG 3 cut(s) 233, 361, 816
BseGI GGATG 2 cut(s) 304, 734
BseLI CCNNNNNNNGG 3 cut(s) 673, 978, 1125
BseMI GCAATG 1 cut(s) 334
BseMII CTCAG 2 cut(s) 458, 566
BseNI ACTGG 4 cut(s) 774, 938, 1085, 1178
BseRI GAGGAG 2 cut(s) 936, 1083
BseXI GCAGC 6 cut(s) 20, 136, 415, 469, 577, 758
BseYI CCCAGC 1 cut(s) 403
BsgI GTGCAG 1 cut(s) 299
BshFI GGCC 1 cut(s) 597
BsiHKAI GWGCWC 2 cut(s) 969, 1116
BsiSI CCGG 2 cut(s) 950, 1097
BslI CCNNNNNNNGG 3 cut(s) 673, 978, 1125
BsmAI GTCTC 4 cut(s) 194, 500, 608, 1235
BsnI GGCC 1 cut(s) 597
Bso31I GGTCTC 1 cut(s) 194
Bsp1286I GDGCHC 3 cut(s) 184, 969, 1116
Bsp143I GATC 4 cut(s) 91, 135, 367, 1186
Bsp19I CCATGG 1 cut(s) 361
BspACI CCGC 5 cut(s) 794, 896, 1017, 1043, 1164
BspANI GGCC 1 cut(s) 597
BspCNI CTCAG 2 cut(s) 459, 567
BspMAI CTGCAG 2 cut(s) 10, 433
BspMI ACCTGC 1 cut(s) 843
BspOI GCTAGC 2 cut(s) 489, 716
BspPI GGATC 3 cut(s) 86, 375, 1181
BspTNI GGTCTC 1 cut(s) 194
BsrBI CCGCTC 2 cut(s) 1017, 1164
BsrDI GCAATG 1 cut(s) 334
BsrI ACTGG 4 cut(s) 774, 938, 1085, 1178
BssECI CCNNGG 3 cut(s) 233, 361, 816
BssMI GATC 4 cut(s) 91, 135, 367, 1186
BssT1I CCWWGG 2 cut(s) 361, 816
Bst2UI CCWGG 2 cut(s) 128, 234
Bst4CI ACNGT 1 cut(s) 1238
BstAPI GCANNNNNTGC 1 cut(s) 752
BstC8I GCNNGC 4 cut(s) 487, 595, 714, 757
BstDEI CTNAG 5 cut(s) 351, 467, 496, 575, 604
BstDSI CCRYGG 1 cut(s) 361
BstEII GGTNACC 1 cut(s) 1232
BstF5I GGATG 2 cut(s) 304, 734
BstH2I RGCGCY 2 cut(s) 524, 632
BstHHI GCGC 2 cut(s) 523, 631
BstKTI GATC 4 cut(s) 94, 138, 370, 1189
BstMAI GTCTC 4 cut(s) 194, 500, 608, 1235
BstMBI GATC 4 cut(s) 91, 135, 367, 1186
BstMWI GCNNNNNNNGC 6 cut(s) 518, 626, 752, 800, 893, 1040
BstNI CCWGG 2 cut(s) 128, 234
BstNSI RCATGY 2 cut(s) 704, 725
BstPAI GACNNNNGTC 2 cut(s) 926, 1073
BstPI GGTNACC 1 cut(s) 1232
BstSCI CCNGG 2 cut(s) 126, 232
BstSFI CTRYAG 5 cut(s) 6, 429, 975, 1122, 1254
BstV1I GCAGC 6 cut(s) 20, 136, 415, 469, 577, 758
BstV2I GAAGAC 2 cut(s) 837, 1028
BstX2I RGATCY 1 cut(s) 367
BstYI RGATCY 1 cut(s) 367
BsuRI GGCC 1 cut(s) 597
BtgI CCRYGG 1 cut(s) 361
BtsCI GGATG 2 cut(s) 304, 734
BtsI GCAGTG 3 cut(s) 423, 894, 1041
BtsIMutI CAGTG 3 cut(s) 423, 894, 1041
BveI ACCTGC 1 cut(s) 843
Cac8I GCNNGC 4 cut(s) 487, 595, 714, 757
CaiI CAGNNNCTG 2 cut(s) 133, 752
CfoI GCGC 2 cut(s) 523, 631
Cfr13I GGNCC 4 cut(s) 124, 935, 1082, 1196
CsiI ACCWGGT 1 cut(s) 126
Csp6I GTAC 4 cut(s) 22, 421, 1181, 1273
CviAII CATG 6 cut(s) 347, 362, 442, 701, 722, 1284
CviQI GTAC 4 cut(s) 22, 421, 1181, 1273
DdeI CTNAG 5 cut(s) 351, 467, 496, 575, 604
DpnI GATC 4 cut(s) 93, 137, 369, 1188
DpnII GATC 4 cut(s) 91, 135, 367, 1186
DraI TTTAAA 1 cut(s) 289
Eco130I CCWWGG 2 cut(s) 361, 816
Eco24I GRGCYC 1 cut(s) 184
Eco31I GGTCTC 1 cut(s) 194
Eco47I GGWCC 4 cut(s) 124, 935, 1082, 1196
Eco47III AGCGCT 2 cut(s) 522, 630
Eco57I CTGAAG 2 cut(s) 1019, 1166
Eco91I GGTNACC 1 cut(s) 1232
EcoO65I GGTNACC 1 cut(s) 1232
EcoRII CCWGG 2 cut(s) 126, 232
EcoT14I CCWWGG 2 cut(s) 361, 816
EcoT38I GRGCYC 1 cut(s) 184
ErhI CCWWGG 2 cut(s) 361, 816
FaeI CATG 6 cut(s) 350, 365, 445, 704, 725, 1287
FalI AAGNNNNNCTT 4 cut(s) 992, 1024, 1139, 1171
FatI CATG 6 cut(s) 346, 361, 441, 700, 721, 1283
FauI CCCGC 2 cut(s) 1010, 1157
FbaI TGATCA 1 cut(s) 135
Fnu4HI GCNGC 7 cut(s) 6, 9, 150, 429, 483, 591, 747
FokI GGATG 2 cut(s) 311, 721
FriOI GRGCYC 1 cut(s) 184
Fsp4HI GCNGC 7 cut(s) 6, 9, 150, 429, 483, 591, 747
FspBI CTAG 3 cut(s) 486, 713, 1248
GlaI GCGC 2 cut(s) 522, 630
GluI GCNGC 7 cut(s) 6, 9, 150, 429, 483, 591, 747
GsaI CCCAGC 1 cut(s) 407
HaeII RGCGCY 2 cut(s) 524, 632
HaeIII GGCC 1 cut(s) 597
HapII CCGG 2 cut(s) 950, 1097
HhaI GCGC 2 cut(s) 523, 631
Hin1II CATG 6 cut(s) 350, 365, 445, 704, 725, 1287
Hin6I GCGC 2 cut(s) 521, 629
HinP1I GCGC 2 cut(s) 521, 629
HindIII AAGCTT 1 cut(s) 784
HinfI GANTC 3 cut(s) 170, 334, 706
HpaII CCGG 2 cut(s) 950, 1097
HphI GGTGA 8 cut(s) 221, 271, 400, 910, 961, 1057, 1108, 1183
Hpy166II GTNNAC 2 cut(s) 423, 1273
Hpy188I TCNGA 6 cut(s) 58, 84, 468, 576, 959, 1106
Hpy188III TCNNGA 3 cut(s) 110, 174, 1248
Hpy8I GTNNAC 2 cut(s) 423, 1273
HpyCH4III ACNGT 1 cut(s) 1238
HpyCH4V TGCA 6 cut(s) 8, 74, 280, 431, 755, 866
HpyF10VI GCNNNNNNNGC 6 cut(s) 518, 626, 752, 800, 893, 1040
HpyF3I CTNAG 5 cut(s) 351, 467, 496, 575, 604
Hsp92II CATG 6 cut(s) 350, 365, 445, 704, 725, 1287
HspAI GCGC 2 cut(s) 521, 629
Ksp22I TGATCA 1 cut(s) 135
Kzo9I GATC 4 cut(s) 91, 135, 367, 1186
LmnI GCTCC 4 cut(s) 16, 518, 626, 643
Lsp1109I GCAGC 6 cut(s) 20, 136, 415, 469, 577, 758
LweI GCATC 2 cut(s) 743, 853
MabI ACCWGGT 1 cut(s) 126
MaeI CTAG 3 cut(s) 486, 713, 1248
MaeIII GTNAC 5 cut(s) 919, 940, 1066, 1087, 1232
MalI GATC 4 cut(s) 93, 137, 369, 1188
MbiI CCGCTC 2 cut(s) 1017, 1164
MboI GATC 4 cut(s) 91, 135, 367, 1186
MboII GAAGA 2 cut(s) 842, 1033
MflI RGATCY 1 cut(s) 367
MhlI GDGCHC 3 cut(s) 184, 969, 1116
MluCI AATT 4 cut(s) 86, 114, 228, 845
MmeI TCCRAC 1 cut(s) 673
MnlI CCTC 6 cut(s) 40, 115, 199, 671, 957, 1104
MseI TTAA 4 cut(s) 117, 159, 288, 779
MspI CCGG 2 cut(s) 950, 1097
MspR9I CCNGG 2 cut(s) 128, 234
MvaI CCWGG 2 cut(s) 128, 234
MwoI GCNNNNNNNGC 6 cut(s) 518, 626, 752, 800, 893, 1040
NcoI CCATGG 1 cut(s) 361
NdeII GATC 4 cut(s) 91, 135, 367, 1186
NheI GCTAGC 2 cut(s) 485, 712
NlaIII CATG 6 cut(s) 350, 365, 445, 704, 725, 1287
NmuCI GTSAC 2 cut(s) 919, 1066
NspI RCATGY 2 cut(s) 704, 725
PciI ACATGT 2 cut(s) 700, 721
PfeI GAWTC 3 cut(s) 170, 334, 706
PkrI GCNGC 7 cut(s) 7, 10, 151, 430, 484, 592, 748
PscI ACATGT 2 cut(s) 700, 721
PshAI GACNNNNGTC 2 cut(s) 926, 1073
Psp6I CCWGG 2 cut(s) 126, 232
PspEI GGTNACC 1 cut(s) 1232
PspFI CCCAGC 1 cut(s) 403
PspGI CCWGG 2 cut(s) 126, 232
PspPI GGNCC 4 cut(s) 124, 935, 1082, 1196
PstI CTGCAG 2 cut(s) 10, 433
PstNI CAGNNNCTG 2 cut(s) 133, 752
PsuI RGATCY 1 cut(s) 367
RsaI GTAC 4 cut(s) 23, 422, 1182, 1274
RsaNI GTAC 4 cut(s) 22, 421, 1181, 1273
SaqAI TTAA 4 cut(s) 117, 159, 288, 779
SatI GCNGC 7 cut(s) 6, 9, 150, 429, 483, 591, 747
Sau3AI GATC 4 cut(s) 91, 135, 367, 1186
Sau96I GGNCC 4 cut(s) 124, 935, 1082, 1196
ScaI AGTACT 1 cut(s) 1182
ScrFI CCNGG 2 cut(s) 128, 234
SduI GDGCHC 3 cut(s) 184, 969, 1116
SexAI ACCWGGT 1 cut(s) 126
SfaNI GCATC 2 cut(s) 743, 853
SfcI CTRYAG 5 cut(s) 6, 429, 975, 1122, 1254
SinI GGWCC 4 cut(s) 124, 935, 1082, 1196
Sse9I AATT 4 cut(s) 86, 114, 228, 845
SsiI CCGC 5 cut(s) 794, 896, 1017, 1043, 1164
SspMI CTAG 3 cut(s) 486, 713, 1248
StyD4I CCNGG 2 cut(s) 126, 232
StyI CCWWGG 2 cut(s) 361, 816
TaaI ACNGT 1 cut(s) 1238
TaqI TCGA 1 cut(s) 828
TasI AATT 4 cut(s) 86, 114, 228, 845
TatI WGTACW 3 cut(s) 21, 420, 1180
TfiI GAWTC 3 cut(s) 170, 334, 706
Tru1I TTAA 4 cut(s) 117, 159, 288, 779
Tru9I TTAA 4 cut(s) 117, 159, 288, 779
TscAI CASTG 3 cut(s) 430, 894, 1041
TseFI GTSAC 2 cut(s) 919, 1066
TseI GCWGC 7 cut(s) 5, 8, 149, 428, 482, 590, 746
Tsp45I GTSAC 2 cut(s) 919, 1066
TspDTI ATGAA 1 cut(s) 315
TspGWI ACGGA 2 cut(s) 652, 656
TspRI CASTG 3 cut(s) 430, 894, 1041
VpaK11BI GGWCC 4 cut(s) 124, 935, 1082, 1196
XapI RAATTY 2 cut(s) 86, 845
XbaI TCTAGA 1 cut(s) 1247
XceI RCATGY 2 cut(s) 704, 725
XspI CTAG 3 cut(s) 486, 713, 1248
ZrmI AGTACT 1 cut(s) 1182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.