Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006976.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 243

Gene Structure 242 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 242 bp

atgattgggaggaagaacatggggcgtgcttcacctttacttctggttctcttggcttttgggtttttctttgccacctacaatcttttgacgatgatactccactatagatctgttgggaagtgggtaggtggtaatagtaacagtcatttgctggctgaccccattgtcgagatgcctgagaatgtgaaagtcaaaggttccaaagcaccattccatgttgccttaacagcaacggatgc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0012505 GO:0016740 GO:0016757 GO:0016763 GO:0031410 GO:0031982 GO:0031984 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0097708 GO:0098791 GO:1990585

KEGG Pathways

Metabolic & Signaling

ko00514 map00514

Pfam Domains

Protein Families

No domains found.

Protein Analysis

81

Amino Acids

8.85

Weight (kDa)

9.87

Isoelectric Point (pI)

30.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	167
AjuI	GAANNNNNNNTTGG	2 cut(s)	197, 229
AsuHPI	GGTGA	1 cut(s)	24
BfmI	CTRYAG	1 cut(s)	106
BglII	AGATCT	1 cut(s)	110
BmiI	GGNNCC	1 cut(s)	202
BmsI	GCATC	2 cut(s)	165, 229
BseMII	CTCAG	1 cut(s)	171
Bsp143I	GATC	1 cut(s)	110
BspCNI	CTCAG	1 cut(s)	172
BspLI	GGNNCC	1 cut(s)	202
BssMI	GATC	1 cut(s)	110
Bst4CI	ACNGT	1 cut(s)	146
BstAPI	GCANNNNNTGC	1 cut(s)	239
BstC8I	GCNNGC	2 cut(s)	27, 156
BstDEI	CTNAG	1 cut(s)	180
BstKTI	GATC	1 cut(s)	113
BstMBI	GATC	1 cut(s)	110
BstMWI	GCNNNNNNNGC	2 cut(s)	230, 239
BstSFI	CTRYAG	1 cut(s)	106
BstX2I	RGATCY	1 cut(s)	110
BstYI	RGATCY	1 cut(s)	110
Cac8I	GCNNGC	2 cut(s)	27, 156
CviAII	CATG	2 cut(s)	19, 218
CviJI	RGCY	2 cut(s)	56, 158
CviKI_1	RGCY	2 cut(s)	56, 158
DdeI	CTNAG	1 cut(s)	180
DpnI	GATC	1 cut(s)	112
DpnII	GATC	1 cut(s)	110
DrdI	GACNNNNNNGTC	1 cut(s)	167
DseDI	GACNNNNNNGTC	1 cut(s)	167
FaeI	CATG	2 cut(s)	22, 221
FaiI	YATR	3 cut(s)	20, 108, 219
FatI	CATG	2 cut(s)	18, 217
Hin1II	CATG	2 cut(s)	22, 221
HphI	GGTGA	1 cut(s)	24
Hpy188III	TCNNGA	1 cut(s)	172
HpyCH4III	ACNGT	1 cut(s)	146
HpyF10VI	GCNNNNNNNGC	2 cut(s)	230, 239
HpyF3I	CTNAG	1 cut(s)	180
Hsp92II	CATG	2 cut(s)	22, 221
Kzo9I	GATC	1 cut(s)	110
LpnPI	CCDG	3 cut(s)	29, 140, 192
LweI	GCATC	2 cut(s)	165, 229
MaeIII	GTNAC	1 cut(s)	140
MalI	GATC	1 cut(s)	112
MboI	GATC	1 cut(s)	110
MboII	GAAGA	1 cut(s)	25
MflI	RGATCY	1 cut(s)	110
MnlI	CCTC	1 cut(s)	3
MseI	TTAA	1 cut(s)	227
MwoI	GCNNNNNNNGC	2 cut(s)	230, 239
NdeII	GATC	1 cut(s)	110
NlaIII	CATG	2 cut(s)	22, 221
NlaIV	GGNNCC	1 cut(s)	202
PspN4I	GGNNCC	1 cut(s)	202
PsuI	RGATCY	1 cut(s)	110
SaqAI	TTAA	1 cut(s)	227
Sau3AI	GATC	1 cut(s)	110
SetI	ASST	4 cut(s)	37, 80, 133, 202
SfaNI	GCATC	2 cut(s)	165, 229
SfcI	CTRYAG	1 cut(s)	106
SgeI	CNNG	8 cut(s)	31, 38, 56, 64, 167, 184, 191, 230
TaaI	ACNGT	1 cut(s)	146
TaqI	TCGA	1 cut(s)	171
Tru1I	TTAA	1 cut(s)	227
Tru9I	TTAA	1 cut(s)	227

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.