Rmu_sc0007367.1_g000013

Carboxylesterase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007367.1
N/A
Physical Location & Seq
Reverse (-)
42655 .. 42945
291 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
atgttggctgctttgtggaggtttagttacccattgactagtggatccgatgaccggtttttcaatccgggaaagcatccgaattttggggagttgggttgtgagaaagtgttggtctgtgttgcggagatggattcgttgaaagatagggggtggtattacagtgaggtgttgaagaagagtggatggaatggagtagtggatggaatgaggtgttccatttgttctatcctacttgtgacaatgttgtggccggccatgctcaagaagataatttcttttatgaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

96

Amino Acids

10.9

Weight (kDa)

8.4

Isoelectric Point (pI)

12.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_3 PF07859 2 - 62 1.9e-06 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 125
AclWI GGATC 2 cut(s) 39, 52
AcoI YGGCCR 2 cut(s) 251, 255
AcsI RAATTY 1 cut(s) 82
AfiI CCNNNNNNNGG 2 cut(s) 54, 86
AgeI ACCGGT 1 cut(s) 54
AgsI TTSAA 3 cut(s) 64, 142, 175
AhlI ACTAGT 1 cut(s) 38
AlwI GGATC 2 cut(s) 39, 52
AoxI GGCC 2 cut(s) 251, 255
ApeKI GCWGC 1 cut(s) 8
ApoI RAATTY 1 cut(s) 82
AsiGI ACCGGT 1 cut(s) 54
AsuC2I CCSGG 1 cut(s) 69
BamHI GGATCC 1 cut(s) 44
BccI CCATC 3 cut(s) 124, 180, 197
BcnI CCSGG 1 cut(s) 69
BcuI ACTAGT 1 cut(s) 38
BfaI CTAG 1 cut(s) 39
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
Bme1390I CCNGG 1 cut(s) 69
BmiI GGNNCC 1 cut(s) 46
BmrFI CCNGG 1 cut(s) 69
BmsI GCATC 1 cut(s) 85
BpuEI CTTGAG 1 cut(s) 248
BpuMI CCSGG 1 cut(s) 69
BsaWI WCCGGW 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 10, 40
Bsc4I CCNNNNNNNGG 2 cut(s) 54, 86
Bse118I RCCGGY 2 cut(s) 54, 253
BseGI GGATG 3 cut(s) 76, 191, 208
BseLI CCNNNNNNNGG 2 cut(s) 54, 86
BshFI GGCC 2 cut(s) 253, 257
BshTI ACCGGT 1 cut(s) 54
BsiSI CCGG 3 cut(s) 55, 68, 254
BslI CCNNNNNNNGG 2 cut(s) 54, 86
BsnI GGCC 2 cut(s) 253, 257
Bsp143I GATC 1 cut(s) 44
BspACI CCGC 1 cut(s) 125
BspANI GGCC 2 cut(s) 253, 257
BspLI GGNNCC 1 cut(s) 46
BspPI GGATC 2 cut(s) 39, 52
BsrFI RCCGGY 2 cut(s) 54, 253
BssAI RCCGGY 2 cut(s) 54, 253
BssMI GATC 1 cut(s) 44
Bst4CI ACNGT 1 cut(s) 164
Bst6I CTCTTC 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 255
BstF5I GGATG 3 cut(s) 76, 191, 208
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstMWI GCNNNNNNNGC 1 cut(s) 259
BstSCI CCNGG 1 cut(s) 67
BstX2I RGATCY 1 cut(s) 44
BstYI RGATCY 1 cut(s) 44
BsuRI GGCC 2 cut(s) 253, 257
BtsCI GGATG 3 cut(s) 76, 191, 208
BtsIMutI CAGTG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 255
Cfr10I RCCGGY 2 cut(s) 54, 253
CspAI ACCGGT 1 cut(s) 54
CviAII CATG 1 cut(s) 259
CviJI RGCY 3 cut(s) 8, 253, 257
CviKI_1 RGCY 3 cut(s) 8, 253, 257
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
EaeI YGGCCR 2 cut(s) 251, 255
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
FaeI CATG 1 cut(s) 262
FaiI YATR 2 cut(s) 260, 284
FatI CATG 1 cut(s) 258
Fnu4HI GCNGC 1 cut(s) 9
FokI GGATG 3 cut(s) 63, 198, 215
FseI GGCCGGCC 1 cut(s) 257
Fsp4HI GCNGC 1 cut(s) 9
FspBI CTAG 1 cut(s) 39
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 2 cut(s) 253, 257
HapII CCGG 3 cut(s) 55, 68, 254
Hin1II CATG 1 cut(s) 262
HinfI GANTC 1 cut(s) 134
HpaII CCGG 3 cut(s) 55, 68, 254
Hpy188I TCNGA 2 cut(s) 49, 81
Hpy188III TCNNGA 1 cut(s) 265
HpyCH4III ACNGT 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 259
Hsp92II CATG 1 cut(s) 262
KroI GCCGGC 1 cut(s) 253
KroNI GCCGGC 1 cut(s) 255
Kzo9I GATC 1 cut(s) 44
LpnPI CCDG 3 cut(s) 68, 81, 267
LweI GCATC 1 cut(s) 85
MaeI CTAG 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 26, 238
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MboII GAAGA 3 cut(s) 187, 190, 280
MflI RGATCY 1 cut(s) 44
MluCI AATT 3 cut(s) 82, 273, 286
MnlI CCTC 3 cut(s) 12, 160, 204
MroNI GCCGGC 1 cut(s) 253
MspI CCGG 3 cut(s) 55, 68, 254
MspR9I CCNGG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 259
NaeI GCCGGC 1 cut(s) 255
NciI CCSGG 1 cut(s) 69
NdeII GATC 1 cut(s) 44
NgoMIV GCCGGC 1 cut(s) 253
NlaIII CATG 1 cut(s) 262
NlaIV GGNNCC 1 cut(s) 46
NmuCI GTSAC 1 cut(s) 238
PdiI GCCGGC 1 cut(s) 255
PfeI GAWTC 1 cut(s) 134
PfoI TCCNGGA 1 cut(s) 67
PinAI ACCGGT 1 cut(s) 54
PkrI GCNGC 1 cut(s) 10
PspN4I GGNNCC 1 cut(s) 46
PsuI RGATCY 1 cut(s) 44
RigI GGCCGGCC 1 cut(s) 257
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 69
SetI ASST 3 cut(s) 23, 171, 215
SfaNI GCATC 1 cut(s) 85
SgeI CNNG 8 cut(s) 51, 67, 80, 81, 248, 266, 271, 277
SmlI CTYRAG 1 cut(s) 263
SmoI CTYRAG 1 cut(s) 263
SpeI ACTAGT 1 cut(s) 38
Sse9I AATT 3 cut(s) 82, 273, 286
SsiI CCGC 1 cut(s) 125
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 67
TaaI ACNGT 1 cut(s) 164
TasI AATT 3 cut(s) 82, 273, 286
TfiI GAWTC 1 cut(s) 134
TscAI CASTG 1 cut(s) 169
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 1 cut(s) 8
Tsp45I GTSAC 1 cut(s) 238
TspRI CASTG 1 cut(s) 169
XapI RAATTY 1 cut(s) 82
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.