Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007392.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

3310 .. 3965

Gene Structure 656 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 456 bp

ctgccgaagtggggcgaagttaacgcttctgagtcgtcgtgtgtagagtctaattctggagttgatattagaggcttcattgagagaaagttgaagctgaagtcaaagagcggaattgcaaaggtaattggtggttataaagcagttatcgaatcagcggtttccgagtctgataaggtctcattgaaattcaaggatcaagaggtcatttcactcaactccagtgtgcaattgtgctcggaagcgacaggtgacggatcaattttggagatcgagtggagcattagatgtggatccggtttgggggttagggtttctagttgggatttggtagagcagaagaggcagaggagggtgagagattgggggtttgagtggtgggttgggagtggagctcggtggaggcaggttggttggaaatgggatcgaagctgggctggtcagagctggaattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000280 GO:0000724 GO:0000725 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0006996 GO:0007049 GO:0007059 GO:0007127 GO:0007129 GO:0007131 GO:0008150 GO:0008152 GO:0009987 GO:0016043 GO:0022402 GO:0022414 GO:0022607 GO:0033554 GO:0034641 GO:0035825 GO:0043170 GO:0044085 GO:0044237 GO:0044238 GO:0044260 GO:0045132 GO:0045143 GO:0046483 GO:0048285 GO:0050896 GO:0051026 GO:0051276 GO:0051321 GO:0051716 GO:0061982 GO:0070192 GO:0071704 GO:0071840 GO:0090304 GO:0098813 GO:0140013 GO:1901360 GO:1903046

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cyclin_C Cyclin_N

Protein Analysis

151

Amino Acids

16.95

Weight (kDa)

9.08

Isoelectric Point (pI)

43.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	138
Acc36I	ACCTGC	1 cut(s)	397
AccBSI	CCGCTC	1 cut(s)	111
AciI	CCGC	2 cut(s)	111, 158
AclWI	GGATC	5 cut(s)	204, 265, 288, 301, 432
AcsI	RAATTY	1 cut(s)	188
AcuI	CTGAAG	1 cut(s)	119
AfiI	CCNNNNNNNGG	2 cut(s)	11, 303
AgsI	TTSAA	3 cut(s)	94, 187, 193
AluBI	AGCT	4 cut(s)	97, 395, 432, 447
AluI	AGCT	4 cut(s)	97, 395, 432, 447
Alw21I	GWGCWC	2 cut(s)	239, 397
Alw26I	GTCTC	1 cut(s)	184
AlwI	GGATC	5 cut(s)	204, 265, 288, 301, 432
ApoI	RAATTY	1 cut(s)	188
AsuHPI	GGTGA	2 cut(s)	263, 367
BamHI	GGATCC	1 cut(s)	293
BanII	GRGCYC	1 cut(s)	397
Bbv12I	GWGCWC	2 cut(s)	239, 397
BcoDI	GTCTC	1 cut(s)	184
BfaI	CTAG	1 cut(s)	318
BfuAI	ACCTGC	1 cut(s)	397
BmiI	GGNNCC	1 cut(s)	295
BplI	GAGNNNNNCTC	2 cut(s)	379, 411
BpmI	CTGGAG	2 cut(s)	78, 205
BsaBI	GATNNNNATC	1 cut(s)	292
BsaI	GGTCTC	1 cut(s)	184
BsaWI	WCCGGW	1 cut(s)	296
BsaXI	ACNNNNNCTCC	2 cut(s)	260, 290
Bsc4I	CCNNNNNNNGG	2 cut(s)	11, 303
Bse1I	ACTGG	1 cut(s)	222
Bse8I	GATNNNNATC	1 cut(s)	292
BseJI	GATNNNNATC	1 cut(s)	292
BseLI	CCNNNNNNNGG	2 cut(s)	11, 303
BseMII	CTCAG	1 cut(s)	21
BseNI	ACTGG	1 cut(s)	222
BseRI	GAGGAG	1 cut(s)	364
BseYI	CCCAGC	1 cut(s)	432
BsiHKAI	GWGCWC	2 cut(s)	239, 397
BsiSI	CCGG	1 cut(s)	297
BslI	CCNNNNNNNGG	2 cut(s)	11, 303
BsmAI	GTCTC	1 cut(s)	184
Bso31I	GGTCTC	1 cut(s)	184
Bsp1286I	GDGCHC	2 cut(s)	239, 397
Bsp143I	GATC	5 cut(s)	196, 257, 270, 293, 424
BspACI	CCGC	2 cut(s)	111, 158
BspCNI	CTCAG	1 cut(s)	22
BspLI	GGNNCC	1 cut(s)	295
BspMI	ACCTGC	1 cut(s)	397
BspPI	GGATC	5 cut(s)	204, 265, 288, 301, 432
BspTNI	GGTCTC	1 cut(s)	184
BsrBI	CCGCTC	1 cut(s)	111
BsrI	ACTGG	1 cut(s)	222
BssMI	GATC	5 cut(s)	196, 257, 270, 293, 424
Bst6I	CTCTTC	1 cut(s)	335
BstDEI	CTNAG	1 cut(s)	30
BstKTI	GATC	5 cut(s)	199, 260, 273, 296, 427
BstMAI	GTCTC	1 cut(s)	184
BstMBI	GATC	5 cut(s)	196, 257, 270, 293, 424
BstMWI	GCNNNNNNNGC	1 cut(s)	343
BstX2I	RGATCY	1 cut(s)	293
BstYI	RGATCY	1 cut(s)	293
BtsIMutI	CAGTG	1 cut(s)	229
BveI	ACCTGC	1 cut(s)	397
CviJI	RGCY	6 cut(s)	75, 97, 395, 432, 437, 447
CviKI_1	RGCY	6 cut(s)	75, 97, 395, 432, 437, 447
DdeI	CTNAG	1 cut(s)	30
DpnI	GATC	5 cut(s)	198, 259, 272, 295, 426
DpnII	GATC	5 cut(s)	196, 257, 270, 293, 424
Eam1104I	CTCTTC	1 cut(s)	335
EarI	CTCTTC	1 cut(s)	335
Ecl136II	GAGCTC	1 cut(s)	395
Eco24I	GRGCYC	1 cut(s)	397
Eco31I	GGTCTC	1 cut(s)	184
Eco53kI	GAGCTC	1 cut(s)	395
Eco57I	CTGAAG	1 cut(s)	119
EcoICRI	GAGCTC	1 cut(s)	395
EcoT38I	GRGCYC	1 cut(s)	397
FaiI	YATR	1 cut(s)	138
FriOI	GRGCYC	1 cut(s)	397
FspBI	CTAG	1 cut(s)	318
GsaI	CCCAGC	1 cut(s)	436
GsuI	CTGGAG	2 cut(s)	78, 205
HapII	CCGG	1 cut(s)	297
HincII	GTYRAC	1 cut(s)	22
HindII	GTYRAC	1 cut(s)	22
HinfI	GANTC	4 cut(s)	32, 47, 152, 167
HpaI	GTTAAC	1 cut(s)	22
HpaII	CCGG	1 cut(s)	297
HphI	GGTGA	2 cut(s)	263, 367
Hpy166II	GTNNAC	1 cut(s)	22
Hpy188I	TCNGA	5 cut(s)	31, 166, 172, 241, 444
Hpy188III	TCNNGA	2 cut(s)	57, 200
Hpy8I	GTNNAC	1 cut(s)	22
Hpy99I	CGWCG	1 cut(s)	40
HpyCH4V	TGCA	2 cut(s)	119, 229
HpyF10VI	GCNNNNNNNGC	1 cut(s)	343
HpyF3I	CTNAG	1 cut(s)	30
KspAI	GTTAAC	1 cut(s)	22
Kzo9I	GATC	5 cut(s)	196, 257, 270, 293, 424
LmnI	GCTCC	2 cut(s)	279, 392
LpnPI	CCDG	8 cut(s)	42, 234, 235, 310, 392, 418, 423, 433
MaeI	CTAG	1 cut(s)	318
MaeIII	GTNAC	1 cut(s)	251
MalI	GATC	5 cut(s)	198, 259, 272, 295, 426
MbiI	CCGCTC	1 cut(s)	111
MboI	GATC	5 cut(s)	196, 257, 270, 293, 424
MboII	GAAGA	1 cut(s)	352
MfeI	CAATTG	1 cut(s)	230
MflI	RGATCY	1 cut(s)	293
MhlI	GDGCHC	2 cut(s)	239, 397
MluCI	AATT	7 cut(s)	52, 114, 126, 188, 230, 261, 451
MlyI	GAGTC	3 cut(s)	41, 56, 176
MmeI	TCCRAC	1 cut(s)	395
MnlI	CCTC	6 cut(s)	65, 196, 336, 342, 345, 396
MseI	TTAA	1 cut(s)	21
MspA1I	CMGCKG	1 cut(s)	158
MspI	CCGG	1 cut(s)	297
MunI	CAATTG	1 cut(s)	230
MwoI	GCNNNNNNNGC	1 cut(s)	343
NdeII	GATC	5 cut(s)	196, 257, 270, 293, 424
NlaIV	GGNNCC	1 cut(s)	295
NmuCI	GTSAC	1 cut(s)	251
PfeI	GAWTC	1 cut(s)	152
PleI	GAGTC	3 cut(s)	40, 55, 175
PpsI	GAGTC	3 cut(s)	40, 55, 175
PsiI	TTATAA	1 cut(s)	138
Psp124BI	GAGCTC	1 cut(s)	397
PspFI	CCCAGC	1 cut(s)	432
PspN4I	GGNNCC	1 cut(s)	295
PsuI	RGATCY	1 cut(s)	293
SacI	GAGCTC	1 cut(s)	397
SaqAI	TTAA	1 cut(s)	21
Sau3AI	GATC	5 cut(s)	196, 257, 270, 293, 424
SchI	GAGTC	3 cut(s)	41, 56, 176
SduI	GDGCHC	2 cut(s)	239, 397
SetI	ASST	9 cut(s)	99, 126, 180, 207, 253, 397, 411, 434, 449
Sse9I	AATT	7 cut(s)	52, 114, 126, 188, 230, 261, 451
SsiI	CCGC	2 cut(s)	111, 158
SspMI	CTAG	1 cut(s)	318
SstI	GAGCTC	1 cut(s)	397
TaqI	TCGA	3 cut(s)	150, 273, 427
TasI	AATT	7 cut(s)	52, 114, 126, 188, 230, 261, 451
TfiI	GAWTC	1 cut(s)	152
Tru1I	TTAA	1 cut(s)	21
Tru9I	TTAA	1 cut(s)	21
TscAI	CASTG	1 cut(s)	229
TseFI	GTSAC	1 cut(s)	251
Tsp45I	GTSAC	1 cut(s)	251
TspDTI	ATGAA	1 cut(s)	67
TspGWI	ACGGA	1 cut(s)	270
TspRI	CASTG	1 cut(s)	229
XapI	RAATTY	1 cut(s)	188
XspI	CTAG	1 cut(s)	318

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.