Rmu_sc0007920.1_g000012

Wall-associated receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007920.1
N/A
Physical Location & Seq
Reverse (-)
31964 .. 32260
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007920.1_g000012.1.cds

Sequence Viewer

Length: 297 bp
atgaacggggcaaacgttgagcagcttaaggaagtttcgagccttgcaaagaggtgtttgaaagtaaaaggaaaagaaagaccaaccatgaaggaagtggcaatggagcttgagggactgagaaggatggtaatgcatccatgggttaataatcatgaatccaatgcggaggagaatgaacacttgcttggtgaaataacactggaaacttttagtcatggaggtggtggggatacgagttctgggtatgataccatgaggaacccgatcacattaccagttgatgataggagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.01

Weight (kDa)

5.78

Isoelectric Point (pI)

44.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 167
AclI AACGTT 1 cut(s) 15
AflII CTTAAG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 61
AjuI GAANNNNNNNTTGG 2 cut(s) 171, 203
AluBI AGCT 2 cut(s) 25, 109
AluI AGCT 2 cut(s) 25, 109
ApeKI GCWGC 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 203
BbvI GCAGC 1 cut(s) 34
BccI CCATC 1 cut(s) 121
BciVI GTATCC 1 cut(s) 226
BfrI CTTAAG 1 cut(s) 26
BfuI GTATCC 1 cut(s) 226
BisI GCNGC 1 cut(s) 23
BlsI GCNGC 1 cut(s) 24
BmiI GGNNCC 1 cut(s) 263
BmsI GCATC 1 cut(s) 145
BpuEI CTTGAG 1 cut(s) 131
BsaJI CCNNGG 1 cut(s) 140
Bse1I ACTGG 2 cut(s) 207, 278
Bse3DI GCAATG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 2 cut(s) 132, 136
BseMI GCAATG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 110
BseNI ACTGG 2 cut(s) 207, 278
BseRI GAGGAG 1 cut(s) 185
BseXI GCAGC 1 cut(s) 34
BslFI GGGAC 1 cut(s) 129
BsmFI GGGAC 1 cut(s) 129
Bsp143I GATC 1 cut(s) 267
Bsp19I CCATGG 1 cut(s) 140
BspACI CCGC 1 cut(s) 167
BspCNI CTCAG 1 cut(s) 111
BspHI TCATGA 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 263
BspTI CTTAAG 1 cut(s) 26
BsrDI GCAATG 1 cut(s) 108
BsrI ACTGG 2 cut(s) 207, 278
BssECI CCNNGG 1 cut(s) 140
BssMI GATC 1 cut(s) 267
BssT1I CCWWGG 1 cut(s) 140
BstAFI CTTAAG 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 119
BstDSI CCRYGG 1 cut(s) 140
BstF5I GGATG 2 cut(s) 132, 136
BstKTI GATC 1 cut(s) 270
BstMBI GATC 1 cut(s) 267
BstV1I GCAGC 1 cut(s) 34
BsuI GTATCC 1 cut(s) 226
BtgI CCRYGG 1 cut(s) 140
BtsCI GGATG 2 cut(s) 132, 136
BtsIMutI CAGTG 1 cut(s) 200
CciI TCATGA 1 cut(s) 154
CviAII CATG 5 cut(s) 88, 141, 155, 218, 256
CviJI RGCY 3 cut(s) 25, 42, 109
CviKI_1 RGCY 3 cut(s) 25, 42, 109
DdeI CTNAG 1 cut(s) 119
DpnI GATC 1 cut(s) 269
DpnII GATC 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 140
EcoT14I CCWWGG 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 140
FaeI CATG 5 cut(s) 91, 144, 158, 221, 259
FaiI YATR 6 cut(s) 89, 142, 156, 219, 249, 257
FaqI GGGAC 1 cut(s) 129
FatI CATG 5 cut(s) 87, 140, 154, 217, 255
Fnu4HI GCNGC 1 cut(s) 23
FokI GGATG 2 cut(s) 123, 139
Fsp4HI GCNGC 1 cut(s) 23
GluI GCNGC 1 cut(s) 23
Hin1II CATG 5 cut(s) 91, 144, 158, 221, 259
HinfI GANTC 1 cut(s) 158
HphI GGTGA 1 cut(s) 203
Hpy188III TCNNGA 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 85, 117
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 2 cut(s) 47, 136
HpyF3I CTNAG 1 cut(s) 119
HpySE526I ACGT 1 cut(s) 15
Hsp92II CATG 5 cut(s) 91, 144, 158, 221, 259
Kzo9I GATC 1 cut(s) 267
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 3 cut(s) 188, 228, 291
Lsp1109I GCAGC 1 cut(s) 34
LweI GCATC 1 cut(s) 145
MaeII ACGT 1 cut(s) 15
MalI GATC 1 cut(s) 269
MboI GATC 1 cut(s) 267
MnlI CCTC 5 cut(s) 45, 106, 163, 215, 252
Mph1103I ATGCAT 1 cut(s) 138
MseI TTAA 2 cut(s) 27, 147
MslI CAYNNNNRTG 1 cut(s) 222
MspCI CTTAAG 1 cut(s) 26
NcoI CCATGG 1 cut(s) 140
NdeII GATC 1 cut(s) 267
NlaIII CATG 5 cut(s) 91, 144, 158, 221, 259
NlaIV GGNNCC 1 cut(s) 263
NsiI ATGCAT 1 cut(s) 138
PagI TCATGA 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 12
PfeI GAWTC 1 cut(s) 158
PkrI GCNGC 1 cut(s) 24
Psp1406I AACGTT 1 cut(s) 15
PspN4I GGNNCC 1 cut(s) 263
RseI CAYNNNNRTG 1 cut(s) 222
SaqAI TTAA 2 cut(s) 27, 147
SatI GCNGC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 267
SetI ASST 5 cut(s) 18, 27, 56, 111, 226
SfaNI GCATC 1 cut(s) 145
SmiMI CAYNNNNRTG 1 cut(s) 222
SmlI CTYRAG 2 cut(s) 26, 110
SmoI CTYRAG 2 cut(s) 26, 110
SsiI CCGC 1 cut(s) 167
StyI CCWWGG 1 cut(s) 140
TaiI ACGT 1 cut(s) 18
TaqI TCGA 1 cut(s) 38
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 2 cut(s) 27, 147
Tru9I TTAA 2 cut(s) 27, 147
TscAI CASTG 1 cut(s) 207
TseI GCWGC 1 cut(s) 22
TspDTI ATGAA 4 cut(s) 17, 104, 171, 192
TspRI CASTG 1 cut(s) 207
Vha464I CTTAAG 1 cut(s) 26
XcmI CCANNNNNNNNNTGG 1 cut(s) 94
Zsp2I ATGCAT 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.