Rmu_sc0008646.1_g000001

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008646.1
N/A
Physical Location & Seq
Forward (+)
2883 .. 3236
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008646.1_g000001.1.cds

Sequence Viewer

Length: 354 bp
atgtctacattttctagttggtgtcttgaggagctggtaaagatcatggagtgtagaagcactgtggggaaaatagtcttcccagtgttctttggtgttgatccttcagatgtcaggaaacagagtggtacttttgcagaggcacttgatcagaaacataaagatatagatgataaggtgcaaagttggggaactgctcttatagaaactgcaggtttgtctggctgggatctgcaaaacacttccctatggtatttgctaattaatcttcttttatttattgctattgcgtgtccacatgatatatcatctttctttgtttgtcgtagatcaagttggatttggatcctctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.32

Weight (kDa)

5.2

Isoelectric Point (pI)

64.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 203
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 4 cut(s) 95, 237, 340, 353
AcuI CTGAAG 1 cut(s) 90
AfaI GTAC 1 cut(s) 130
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AlwI GGATC 4 cut(s) 95, 237, 340, 353
AseI ATTAAT 1 cut(s) 264
BamHI GGATCC 1 cut(s) 345
BbsI GAAGAC 1 cut(s) 70
BclI TGATCA 1 cut(s) 148
BfaI CTAG 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 210
BfuAI ACCTGC 1 cut(s) 203
BmiI GGNNCC 1 cut(s) 347
BmrI ACTGGG 1 cut(s) 77
BmuI ACTGGG 1 cut(s) 77
BpiI GAAGAC 1 cut(s) 70
BpuEI CTTGAG 1 cut(s) 47
BsaBI GATNNNNATC 1 cut(s) 344
Bse1I ACTGG 1 cut(s) 83
Bse8I GATNNNNATC 1 cut(s) 344
BseJI GATNNNNATC 1 cut(s) 344
BseNI ACTGG 1 cut(s) 83
BseRI GAGGAG 1 cut(s) 44
BseYI CCCAGC 1 cut(s) 225
Bsp143I GATC 6 cut(s) 42, 100, 148, 229, 329, 345
BspLI GGNNCC 1 cut(s) 347
BspMAI CTGCAG 1 cut(s) 214
BspMI ACCTGC 1 cut(s) 203
BspPI GGATC 4 cut(s) 95, 237, 340, 353
BsrI ACTGG 1 cut(s) 83
BssMI GATC 6 cut(s) 42, 100, 148, 229, 329, 345
Bst4CI ACNGT 1 cut(s) 64
BstKTI GATC 6 cut(s) 45, 103, 151, 232, 332, 348
BstMBI GATC 6 cut(s) 42, 100, 148, 229, 329, 345
BstSFI CTRYAG 1 cut(s) 210
BstV2I GAAGAC 1 cut(s) 70
BstX2I RGATCY 2 cut(s) 229, 345
BstYI RGATCY 2 cut(s) 229, 345
BtsIMutI CAGTG 2 cut(s) 60, 90
BveI ACCTGC 1 cut(s) 203
Csp6I GTAC 1 cut(s) 129
CviAII CATG 2 cut(s) 46, 299
CviJI RGCY 2 cut(s) 34, 225
CviKI_1 RGCY 2 cut(s) 34, 225
CviQI GTAC 1 cut(s) 129
DpnI GATC 6 cut(s) 44, 102, 150, 231, 331, 347
DpnII GATC 6 cut(s) 42, 100, 148, 229, 329, 345
Eco57I CTGAAG 1 cut(s) 90
FaeI CATG 2 cut(s) 49, 302
FaiI YATR 7 cut(s) 47, 159, 167, 203, 250, 300, 305
FatI CATG 2 cut(s) 45, 298
FbaI TGATCA 1 cut(s) 148
FblI GTMKAC 1 cut(s) 5
FspBI CTAG 1 cut(s) 15
GsaI CCCAGC 1 cut(s) 229
Hin1II CATG 2 cut(s) 49, 302
Hpy166II GTNNAC 2 cut(s) 6, 296
Hpy188I TCNGA 2 cut(s) 109, 153
Hpy188III TCNNGA 2 cut(s) 26, 115
Hpy8I GTNNAC 2 cut(s) 6, 296
HpyAV CCTTC 1 cut(s) 114
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 4 cut(s) 137, 181, 212, 235
Hsp92II CATG 2 cut(s) 49, 302
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 6 cut(s) 42, 100, 148, 229, 329, 345
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 6 cut(s) 20, 96, 100, 198, 207, 211
MaeI CTAG 1 cut(s) 15
MalI GATC 6 cut(s) 44, 102, 150, 231, 331, 347
MboI GATC 6 cut(s) 42, 100, 148, 229, 329, 345
MboII GAAGA 2 cut(s) 70, 260
MflI RGATCY 2 cut(s) 229, 345
MluCI AATT 1 cut(s) 261
MmeI TCCRAC 1 cut(s) 317
MnlI CCTC 2 cut(s) 22, 133
MseI TTAA 1 cut(s) 264
NdeII GATC 6 cut(s) 42, 100, 148, 229, 329, 345
NlaIII CATG 2 cut(s) 49, 302
NlaIV GGNNCC 1 cut(s) 347
PshBI ATTAAT 1 cut(s) 264
PspFI CCCAGC 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 347
PstI CTGCAG 1 cut(s) 214
PsuI RGATCY 2 cut(s) 229, 345
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SaqAI TTAA 1 cut(s) 264
Sau3AI GATC 6 cut(s) 42, 100, 148, 229, 329, 345
SetI ASST 3 cut(s) 36, 180, 217
SfcI CTRYAG 1 cut(s) 210
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
Sse9I AATT 1 cut(s) 261
SspMI CTAG 1 cut(s) 15
TaaI ACNGT 1 cut(s) 64
TasI AATT 1 cut(s) 261
Tru1I TTAA 1 cut(s) 264
Tru9I TTAA 1 cut(s) 264
TscAI CASTG 2 cut(s) 67, 90
TspRI CASTG 2 cut(s) 67, 90
VspI ATTAAT 1 cut(s) 264
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.