Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009869.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

30568 .. 31792

Gene Structure 1225 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009869.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

atgcttcgaagagttgctgggttgctgttgtccatcccgactctcaaacaccaaacttgtcggccgtctcccagttcagaacttcagatcggttccaccttccagagttccaggttcaaggaggccacgttattcgatcaattgcgagaaaagacaggcacaacaagactacacgtccaagggcctaagaaacaggaggtccagctttcaactcaatatgccatagagttctatgatattcaagatcgtcttggctttgatagaccaagcaaggccattgactggtctcccacatgggagacaactgatctcctccatcgagttcttcattttgctggaatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0007275 GO:0008150 GO:0009653 GO:0009889 GO:0009965 GO:0009987 GO:0010016 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0030154 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0040034 GO:0045962 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0048869 GO:0050789 GO:0050793 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0099402 GO:0140110 GO:1903506 GO:1905392 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TCP

Protein Analysis

114

Amino Acids

13.1

Weight (kDa)

9.3

Isoelectric Point (pI)

58.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	282
AcoI	YGGCCR	1 cut(s)	62
AcsI	RAATTY	1 cut(s)	339
AcuI	CTGAAG	1 cut(s)	68
AfiI	CCNNNNNNNGG	1 cut(s)	282
AflIII	ACRYGT	1 cut(s)	172
AgsI	TTSAA	3 cut(s)	118, 210, 242
AhdI	GACNNNNNGTC	1 cut(s)	173
AjiI	CACGTC	1 cut(s)	175
AjnI	CCWGG	1 cut(s)	110
AluBI	AGCT	1 cut(s)	205
AluI	AGCT	1 cut(s)	205
Alw26I	GTCTC	3 cut(s)	72, 291, 293
AoxI	GGCC	4 cut(s)	62, 123, 182, 273
ApoI	RAATTY	1 cut(s)	339
AspS9I	GGNCC	2 cut(s)	182, 199
AsuII	TTCGAA	1 cut(s)	7
AvaII	GGWCC	1 cut(s)	199
BccI	CCATC	2 cut(s)	41, 324
BceAI	ACGGC	1 cut(s)	49
BciT130I	CCWGG	1 cut(s)	112
BcoDI	GTCTC	3 cut(s)	72, 291, 293
Bme1390I	CCNGG	1 cut(s)	112
Bme18I	GGWCC	1 cut(s)	199
BmeRI	GACNNNNNGTC	1 cut(s)	173
BmgBI	CACGTC	1 cut(s)	175
BmgT120I	GGNCC	2 cut(s)	182, 199
BmiI	GGNNCC	1 cut(s)	94
BmrFI	CCNGG	1 cut(s)	112
BmrI	ACTGGG	1 cut(s)	66
BmuI	ACTGGG	1 cut(s)	66
Bpu14I	TTCGAA	1 cut(s)	7
BsaI	GGTCTC	1 cut(s)	291
BsaJI	CCNNGG	1 cut(s)	178
BsaXI	ACNNNNNCTCC	2 cut(s)	113, 143
Bsc4I	CCNNNNNNNGG	1 cut(s)	282
Bse1I	ACTGG	2 cut(s)	72, 287
BseBI	CCWGG	1 cut(s)	112
BseDI	CCNNGG	1 cut(s)	178
BseGI	GGATG	1 cut(s)	33
BseLI	CCNNNNNNNGG	1 cut(s)	282
BseNI	ACTGG	2 cut(s)	72, 287
BseRI	GAGGAG	1 cut(s)	302
BseX3I	CGGCCG	1 cut(s)	62
BseYI	CCCAGC	1 cut(s)	17
Bsh1285I	CGRYCG	1 cut(s)	65
BshFI	GGCC	4 cut(s)	64, 125, 184, 275
BsiEI	CGRYCG	1 cut(s)	65
BslI	CCNNNNNNNGG	1 cut(s)	282
BsmAI	GTCTC	3 cut(s)	72, 291, 293
BsmBI	CGTCTC	1 cut(s)	72
BsnI	GGCC	4 cut(s)	64, 125, 184, 275
Bso31I	GGTCTC	1 cut(s)	291
Bsp119I	TTCGAA	1 cut(s)	7
Bsp143I	GATC	4 cut(s)	87, 136, 244, 307
BspANI	GGCC	4 cut(s)	64, 125, 184, 275
BspLI	GGNNCC	1 cut(s)	94
BspT104I	TTCGAA	1 cut(s)	7
BspTNI	GGTCTC	1 cut(s)	291
BsrI	ACTGG	2 cut(s)	72, 287
BssECI	CCNNGG	1 cut(s)	178
BssMI	GATC	4 cut(s)	87, 136, 244, 307
BssT1I	CCWWGG	1 cut(s)	178
Bst2UI	CCWGG	1 cut(s)	112
Bst6I	CTCTTC	1 cut(s)	4
BstBI	TTCGAA	1 cut(s)	7
BstDEI	CTNAG	1 cut(s)	186
BstF5I	GGATG	1 cut(s)	33
BstKTI	GATC	4 cut(s)	90, 139, 247, 310
BstMAI	GTCTC	3 cut(s)	72, 291, 293
BstMBI	GATC	4 cut(s)	87, 136, 244, 307
BstMCI	CGRYCG	1 cut(s)	65
BstNI	CCWGG	1 cut(s)	112
BstSCI	CCNGG	1 cut(s)	110
BstZI	CGGCCG	1 cut(s)	62
BsuRI	GGCC	4 cut(s)	64, 125, 184, 275
BtrI	CACGTC	1 cut(s)	175
BtsCI	GGATG	1 cut(s)	33
Cfr13I	GGNCC	2 cut(s)	182, 199
CviAII	CATG	1 cut(s)	294
CviJI	RGCY	6 cut(s)	64, 125, 184, 205, 255, 275
CviKI_1	RGCY	6 cut(s)	64, 125, 184, 205, 255, 275
DdeI	CTNAG	1 cut(s)	186
DpnI	GATC	4 cut(s)	89, 138, 246, 309
DpnII	GATC	4 cut(s)	87, 136, 244, 307
DriI	GACNNNNNGTC	1 cut(s)	173
EaeI	YGGCCR	1 cut(s)	62
EagI	CGGCCG	1 cut(s)	62
Eam1104I	CTCTTC	1 cut(s)	4
Eam1105I	GACNNNNNGTC	1 cut(s)	173
EarI	CTCTTC	1 cut(s)	4
EclXI	CGGCCG	1 cut(s)	62
Eco130I	CCWWGG	1 cut(s)	178
Eco31I	GGTCTC	1 cut(s)	291
Eco47I	GGWCC	1 cut(s)	199
Eco52I	CGGCCG	1 cut(s)	62
Eco57I	CTGAAG	1 cut(s)	68
EcoO109I	RGGNCCY	1 cut(s)	182
EcoRII	CCWGG	1 cut(s)	110
EcoT14I	CCWWGG	1 cut(s)	178
ErhI	CCWWGG	1 cut(s)	178
Esp3I	CGTCTC	1 cut(s)	72
FaeI	CATG	1 cut(s)	297
FaiI	YATR	4 cut(s)	219, 224, 234, 295
FalI	AAGNNNNNCTT	2 cut(s)	234, 266
FatI	CATG	1 cut(s)	293
FokI	GGATG	1 cut(s)	20
GsaI	CCCAGC	1 cut(s)	21
HaeIII	GGCC	4 cut(s)	64, 125, 184, 275
Hin1II	CATG	1 cut(s)	297
HinfI	GANTC	1 cut(s)	40
Hpy188I	TCNGA	2 cut(s)	79, 87
Hpy188III	TCNNGA	3 cut(s)	37, 103, 242
HpyAV	CCTTC	1 cut(s)	109
HpyCH4IV	ACGT	2 cut(s)	128, 174
HpyF3I	CTNAG	1 cut(s)	186
HpySE526I	ACGT	2 cut(s)	128, 174
Hsp92II	CATG	1 cut(s)	297
Kzo9I	GATC	4 cut(s)	87, 136, 244, 307
MaeII	ACGT	2 cut(s)	128, 174
MalI	GATC	4 cut(s)	89, 138, 246, 309
MboI	GATC	4 cut(s)	87, 136, 244, 307
MboII	GAAGA	2 cut(s)	21, 317
MfeI	CAATTG	1 cut(s)	140
MluCI	AATT	2 cut(s)	140, 339
MlyI	GAGTC	1 cut(s)	34
MnlI	CCTC	3 cut(s)	115, 190, 323
MspR9I	CCNGG	1 cut(s)	112
MunI	CAATTG	1 cut(s)	140
MvaI	CCWGG	1 cut(s)	112
NdeII	GATC	4 cut(s)	87, 136, 244, 307
NlaIII	CATG	1 cut(s)	297
NlaIV	GGNNCC	1 cut(s)	94
NspV	TTCGAA	1 cut(s)	7
PflMI	CCANNNNNTGG	1 cut(s)	282
PleI	GAGTC	1 cut(s)	34
PpsI	GAGTC	1 cut(s)	34
Psp6I	CCWGG	1 cut(s)	110
PspFI	CCCAGC	1 cut(s)	17
PspGI	CCWGG	1 cut(s)	110
PspN4I	GGNNCC	1 cut(s)	94
PspPI	GGNCC	2 cut(s)	182, 199
Sau3AI	GATC	4 cut(s)	87, 136, 244, 307
Sau96I	GGNCC	2 cut(s)	182, 199
SchI	GAGTC	1 cut(s)	34
ScrFI	CCNGG	1 cut(s)	112
SetI	ASST	6 cut(s)	101, 116, 131, 177, 201, 207
SfuI	TTCGAA	1 cut(s)	7
SinI	GGWCC	1 cut(s)	199
Sse9I	AATT	2 cut(s)	140, 339
StyD4I	CCNGG	1 cut(s)	110
StyI	CCWWGG	1 cut(s)	178
TaiI	ACGT	2 cut(s)	131, 177
TaqI	TCGA	3 cut(s)	7, 135, 319
TasI	AATT	2 cut(s)	140, 339
TspDTI	ATGAA	1 cut(s)	317
Van91I	CCANNNNNTGG	1 cut(s)	282
VpaK11BI	GGWCC	1 cut(s)	199
XapI	RAATTY	1 cut(s)	339

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.