Rmu_sc0010328.1_g000001

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010328.1
N/A
Physical Location & Seq
Forward (+)
8482 .. 8922
441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010328.1_g000001.1.cds

Sequence Viewer

Length: 441 bp
atgcaatggggttcacacagactgacctctctcataaacttgagaatctacttcagaaaatgtgaagacatagattcatatctggaggaggcactgctgcctagtgctctcacttcactcggcatctcgaatttgaatattaagaccatggaaggcgaggggtttagagacagttctcttgaaaggttgaaaatatgtcaatgccctaagctccagtctttcccatttgaaaggctaacctctcttcctgaagttcaaatcttcaaatgtcctttgctaggaaatggtgtcggaggagaagagagaaggttccccgacgatattatttccaaatcaccaacagtctcagttctaatggtaactatgcaatactctctcctctacttgtttaacacactgcttcaatttgattttggcaatggttttaaaagtactgcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

16.57

Weight (kDa)

5.84

Isoelectric Point (pI)

36.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 130
AcuI CTGAAG 2 cut(s) 37, 270
AfaI GTAC 1 cut(s) 433
AfiI CCNNNNNNNGG 1 cut(s) 278
AgsI TTSAA 7 cut(s) 136, 182, 190, 230, 257, 265, 404
AluBI AGCT 1 cut(s) 211
AluI AGCT 1 cut(s) 211
Alw21I GWGCWC 1 cut(s) 109
Alw26I GTCTC 2 cut(s) 162, 349
ApeKI GCWGC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 130
AsuHPI GGTGA 1 cut(s) 327
BbsI GAAGAC 1 cut(s) 72
Bbv12I GWGCWC 1 cut(s) 109
BbvI GCAGC 1 cut(s) 84
BcoDI GTCTC 2 cut(s) 162, 349
BfaI CTAG 2 cut(s) 102, 278
BisI GCNGC 1 cut(s) 98
BlsI GCNGC 1 cut(s) 99
BmcAI AGTACT 1 cut(s) 433
BmiI GGNNCC 1 cut(s) 311
BmsI GCATC 1 cut(s) 132
BpiI GAAGAC 1 cut(s) 72
BpmI CTGGAG 2 cut(s) 104, 197
Bpu10I CCTNAGC 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 147
Bsc4I CCNNNNNNNGG 1 cut(s) 278
Bse1I ACTGG 1 cut(s) 214
Bse3DI GCAATG 2 cut(s) 11, 424
Bse8I GATNNNNATC 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 147
BseJI GATNNNNATC 1 cut(s) 78
BseLI CCNNNNNNNGG 1 cut(s) 278
BseMI GCAATG 2 cut(s) 11, 424
BseMII CTCAG 1 cut(s) 360
BseNI ACTGG 1 cut(s) 214
BseRI GAGGAG 3 cut(s) 101, 309, 368
BseXI GCAGC 1 cut(s) 84
BsiHKAI GWGCWC 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 278
BsmAI GTCTC 2 cut(s) 162, 349
Bsp1286I GDGCHC 1 cut(s) 109
Bsp19I CCATGG 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 359
BspLI GGNNCC 1 cut(s) 311
BsrDI GCAATG 2 cut(s) 11, 424
BsrI ACTGG 1 cut(s) 214
BssECI CCNNGG 1 cut(s) 147
BssT1I CCWWGG 1 cut(s) 147
Bst4CI ACNGT 2 cut(s) 173, 343
Bst6I CTCTTC 2 cut(s) 249, 294
BstDEI CTNAG 2 cut(s) 207, 346
BstDSI CCRYGG 1 cut(s) 147
BstENI CCTNNNNNAGG 1 cut(s) 276
BstMAI GTCTC 2 cut(s) 162, 349
BstV1I GCAGC 1 cut(s) 84
BstV2I GAAGAC 1 cut(s) 72
BtgI CCRYGG 1 cut(s) 147
BtsI GCAGTG 2 cut(s) 92, 395
BtsIMutI CAGTG 2 cut(s) 92, 395
Csp6I GTAC 1 cut(s) 432
CviAII CATG 1 cut(s) 148
CviJI RGCY 2 cut(s) 211, 235
CviKI_1 RGCY 2 cut(s) 211, 235
CviQI GTAC 1 cut(s) 432
DdeI CTNAG 2 cut(s) 207, 346
DraI TTTAAA 1 cut(s) 427
Eam1104I CTCTTC 2 cut(s) 249, 294
EarI CTCTTC 2 cut(s) 249, 294
Eco130I CCWWGG 1 cut(s) 147
Eco57I CTGAAG 2 cut(s) 37, 270
EcoNI CCTNNNNNAGG 1 cut(s) 276
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 1 cut(s) 151
FaiI YATR 6 cut(s) 35, 71, 79, 149, 196, 365
FalI AAGNNNNNCTT 1 cut(s) 421
FatI CATG 1 cut(s) 147
Fnu4HI GCNGC 1 cut(s) 98
Fsp4HI GCNGC 1 cut(s) 98
FspBI CTAG 2 cut(s) 102, 278
GluI GCNGC 1 cut(s) 98
GsuI CTGGAG 2 cut(s) 104, 197
Hin1II CATG 1 cut(s) 151
HinfI GANTC 2 cut(s) 45, 74
HphI GGTGA 1 cut(s) 327
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 2 cut(s) 56, 293
Hpy188III TCNNGA 4 cut(s) 83, 127, 179, 248
Hpy8I GTNNAC 1 cut(s) 14
Hpy99I CGWCG 1 cut(s) 320
HpyAV CCTTC 2 cut(s) 146, 300
HpyCH4III ACNGT 2 cut(s) 173, 343
HpyCH4V TGCA 2 cut(s) 4, 367
HpyF3I CTNAG 2 cut(s) 207, 346
Hsp92II CATG 1 cut(s) 151
LmnI GCTCC 1 cut(s) 216
LpnPI CCDG 3 cut(s) 68, 227, 261
Lsp1109I GCAGC 1 cut(s) 84
LweI GCATC 1 cut(s) 132
MaeI CTAG 2 cut(s) 102, 278
MaeIII GTNAC 1 cut(s) 358
MboII GAAGA 4 cut(s) 77, 236, 253, 311
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 2 cut(s) 130, 404
MmeI TCCRAC 1 cut(s) 271
MnlI CCTC 7 cut(s) 37, 79, 82, 151, 250, 287, 389
MseI TTAA 4 cut(s) 141, 390, 426, 439
NcoI CCATGG 1 cut(s) 147
NlaIII CATG 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 311
NmeAIII GCCGAG 1 cut(s) 99
PfeI GAWTC 2 cut(s) 45, 74
PkrI GCNGC 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 311
RsaI GTAC 1 cut(s) 433
RsaNI GTAC 1 cut(s) 432
SaqAI TTAA 4 cut(s) 141, 390, 426, 439
SatI GCNGC 1 cut(s) 98
ScaI AGTACT 1 cut(s) 433
SduI GDGCHC 1 cut(s) 109
SetI ASST 5 cut(s) 29, 188, 213, 242, 311
SfaNI GCATC 1 cut(s) 132
SmlI CTYRAG 1 cut(s) 40
SmoI CTYRAG 1 cut(s) 40
Sse9I AATT 2 cut(s) 130, 404
SspI AATATT 1 cut(s) 139
SspMI CTAG 2 cut(s) 102, 278
StyI CCWWGG 1 cut(s) 147
TaaI ACNGT 2 cut(s) 173, 343
TaqI TCGA 1 cut(s) 128
TasI AATT 2 cut(s) 130, 404
TatI WGTACW 1 cut(s) 431
TfiI GAWTC 2 cut(s) 45, 74
Tru1I TTAA 4 cut(s) 141, 390, 426, 439
Tru9I TTAA 4 cut(s) 141, 390, 426, 439
TscAI CASTG 2 cut(s) 99, 402
TseI GCWGC 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 66
TspRI CASTG 2 cut(s) 99, 402
XagI CCTNNNNNAGG 1 cut(s) 276
XapI RAATTY 1 cut(s) 130
XspI CTAG 2 cut(s) 102, 278
ZrmI AGTACT 1 cut(s) 433
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.