Rmu_sc0013402.1_g000007

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013402.1
N/A
Physical Location & Seq
Reverse (-)
40045 .. 40389
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013402.1_g000007.1.cds

Sequence Viewer

Length: 345 bp
atgtctaatgggtctcttaacaagtacatatttcttcaacaaggagtgagctccttaagtttcaagaaaatctttgaaattgcgcttgaagttgctcgtggtatcgactatctgcatcaagggtgtgatttgcaaattttgcactttgacatcaagcctcataacattcttctggacgagaattttaatccaaaggtttctgatcttgggttagcaaggttatactcattggataatagcattgtgtctttgactgcagcaagaggcacaatgggaaacatagctcccgacgcattaggcatgaatcagacgatcatgtggatatgtaagggaaaactactgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.64

Weight (kDa)

6.81

Isoelectric Point (pI)

28.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 135, 181
AfaI GTAC 1 cut(s) 26
AflII CTTAAG 1 cut(s) 55
AgsI TTSAA 4 cut(s) 38, 64, 77, 89
AluBI AGCT 2 cut(s) 51, 284
AluI AGCT 2 cut(s) 51, 284
Alw21I GWGCWC 1 cut(s) 53
Alw26I GTCTC 1 cut(s) 18
ApeKI GCWGC 1 cut(s) 257
ApoI RAATTY 2 cut(s) 135, 181
AspLEI GCGC 1 cut(s) 85
BanII GRGCYC 1 cut(s) 53
BauI CACGAG 1 cut(s) 96
Bbv12I GWGCWC 1 cut(s) 53
BbvI GCAGC 1 cut(s) 269
BcoDI GTCTC 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 255
BfrI CTTAAG 1 cut(s) 55
BisI GCNGC 1 cut(s) 258
BlsI GCNGC 1 cut(s) 259
BmsI GCATC 1 cut(s) 124
BsaI GGTCTC 1 cut(s) 18
BseXI GCAGC 1 cut(s) 269
BsiHKAI GWGCWC 1 cut(s) 53
BsmAI GTCTC 1 cut(s) 18
Bso31I GGTCTC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 53
Bsp143I GATC 2 cut(s) 202, 312
BspMAI CTGCAG 1 cut(s) 259
BspTI CTTAAG 1 cut(s) 55
BspTNI GGTCTC 1 cut(s) 18
BssMI GATC 2 cut(s) 202, 312
BssSI CACGAG 1 cut(s) 96
Bst2BI CACGAG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 342
BstAFI CTTAAG 1 cut(s) 55
BstAPI GCANNNNNTGC 1 cut(s) 139
BstHHI GCGC 1 cut(s) 85
BstKTI GATC 2 cut(s) 205, 315
BstMAI GTCTC 1 cut(s) 18
BstMBI GATC 2 cut(s) 202, 312
BstMWI GCNNNNNNNGC 2 cut(s) 139, 290
BstSFI CTRYAG 1 cut(s) 255
BstV1I GCAGC 1 cut(s) 269
CfoI GCGC 1 cut(s) 85
CseI GACGC 1 cut(s) 299
Csp6I GTAC 1 cut(s) 25
CviAII CATG 2 cut(s) 301, 316
CviJI RGCY 3 cut(s) 51, 157, 284
CviKI_1 RGCY 3 cut(s) 51, 157, 284
CviQI GTAC 1 cut(s) 25
DpnI GATC 2 cut(s) 204, 314
DpnII GATC 2 cut(s) 202, 312
Ecl136II GAGCTC 1 cut(s) 51
Eco24I GRGCYC 1 cut(s) 53
Eco31I GGTCTC 1 cut(s) 18
Eco53kI GAGCTC 1 cut(s) 51
EcoICRI GAGCTC 1 cut(s) 51
EcoT38I GRGCYC 1 cut(s) 53
FaeI CATG 2 cut(s) 304, 319
FaiI YATR 7 cut(s) 29, 162, 223, 281, 302, 317, 325
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FatI CATG 2 cut(s) 300, 315
Fnu4HI GCNGC 1 cut(s) 258
FriOI GRGCYC 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 258
GlaI GCGC 1 cut(s) 84
GluI GCNGC 1 cut(s) 258
HgaI GACGC 1 cut(s) 299
HhaI GCGC 1 cut(s) 85
Hin1II CATG 2 cut(s) 304, 319
Hin6I GCGC 1 cut(s) 83
HinP1I GCGC 1 cut(s) 83
HinfI GANTC 1 cut(s) 304
Hpy188I TCNGA 2 cut(s) 202, 309
Hpy188III TCNNGA 3 cut(s) 64, 173, 287
Hpy99I CGWCG 1 cut(s) 293
HpyCH4III ACNGT 1 cut(s) 342
HpyCH4V TGCA 4 cut(s) 115, 133, 142, 257
HpyF10VI GCNNNNNNNGC 2 cut(s) 139, 290
Hsp92II CATG 2 cut(s) 304, 319
HspAI GCGC 1 cut(s) 83
Kzo9I GATC 2 cut(s) 202, 312
LmnI GCTCC 2 cut(s) 56, 289
LpnPI CCDG 1 cut(s) 158
Lsp1109I GCAGC 1 cut(s) 269
LweI GCATC 1 cut(s) 124
MalI GATC 2 cut(s) 204, 314
MboI GATC 2 cut(s) 202, 312
MboII GAAGA 2 cut(s) 26, 161
MhlI GDGCHC 1 cut(s) 53
MluCI AATT 3 cut(s) 78, 135, 181
MnlI CCTC 2 cut(s) 168, 257
MseI TTAA 3 cut(s) 18, 56, 186
MspCI CTTAAG 1 cut(s) 55
MwoI GCNNNNNNNGC 2 cut(s) 139, 290
NdeII GATC 2 cut(s) 202, 312
NlaIII CATG 2 cut(s) 304, 319
PfeI GAWTC 1 cut(s) 304
PkrI GCNGC 1 cut(s) 259
Psp124BI GAGCTC 1 cut(s) 53
PstI CTGCAG 1 cut(s) 259
RsaI GTAC 1 cut(s) 26
RsaNI GTAC 1 cut(s) 25
SacI GAGCTC 1 cut(s) 53
SaqAI TTAA 3 cut(s) 18, 56, 186
SatI GCNGC 1 cut(s) 258
Sau3AI GATC 2 cut(s) 202, 312
SduI GDGCHC 1 cut(s) 53
SetI ASST 4 cut(s) 53, 198, 221, 286
SfaNI GCATC 1 cut(s) 124
SfcI CTRYAG 1 cut(s) 255
SmlI CTYRAG 1 cut(s) 55
SmoI CTYRAG 1 cut(s) 55
Sse9I AATT 3 cut(s) 78, 135, 181
SstI GAGCTC 1 cut(s) 53
TaaI ACNGT 1 cut(s) 342
TaqI TCGA 1 cut(s) 105
TasI AATT 3 cut(s) 78, 135, 181
TatI WGTACW 1 cut(s) 24
TfiI GAWTC 1 cut(s) 304
Tru1I TTAA 3 cut(s) 18, 56, 186
Tru9I TTAA 3 cut(s) 18, 56, 186
TseI GCWGC 1 cut(s) 257
TspDTI ATGAA 1 cut(s) 317
Vha464I CTTAAG 1 cut(s) 55
XapI RAATTY 2 cut(s) 135, 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.