Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014203.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

28729 .. 31742

Gene Structure 3014 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014203.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 720 bp

atggatccttgtcttcttagtccaaaaccagcatctcgacatcttccgtggccagctggaccgccgaaccccagccatattgagatgatcagagagagggctgtgaaattgagtagggttgtttatcgccatttcgtgttcaaattaagtgggctaaaagaatcattatgcacacttgttggaggtggacgcttcggggctggtgggcacttaacttgctctgatggagggagtttggatcctttgtcttttggggttgttgaagatgttgacttgttggcatccgcggatccatacacttgtaatatagaacgcaagccatatgatcacaaagctgatgtatttagctttgcaattgtgttatgggagatgctgactggaaagcttccatatgaatacttgaccccactacaagctgctgttggagtggtccacaagggcttacggccaaccattccaaagcaaactcatccaaagcttactgagttacttgagaaatgctggcaacaagatccaacattaagacccgacttctcagaaatcatagagatgctgcaaccattagccaaggaggtaatctggttgtgggtacacgacattgctttatgtgttggctttaagccattgcgaaaattggtgatgaaggagaagaacgacgcaagtcatctggaggatttctgtccgtccctagacgaggtcatcactaatcaaggcacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0035556 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko01521 ko01522 ko04010 ko04012 ko04013 ko04015 ko04024 ko04062 ko04068 ko04150 ko04214 ko04270 ko04320 ko04510 ko04650 ko04720 ko04722 ko04726 ko04730 ko04810 ko04910 ko04914 ko04934 ko05034 ko05160 ko05200 ko05205 ko05210 ko05211 ko05212 ko05213 ko05214 ko05215 ko05216 ko05218 ko05219 ko05220 ko05221 ko05223 ko05224 ko05225 ko05226 map01521 map01522 map04010 map04012 map04013 map04015 map04024 map04062 map04068 map04150 map04214 map04270 map04320 map04510 map04650 map04720 map04722 map04726 map04730 map04810 map04910 map04914 map04934 map05034 map05160 map05200 map05205 map05210 map05211 map05212 map05213 map05214 map05215 map05216 map05218 map05219 map05220 map05221 map05223 map05224 map05225 map05226

Pfam Domains

Protein Families

ACT Pkinase_Tyr

Protein Analysis

239

Amino Acids

26.72

Weight (kDa)

6.3

Isoelectric Point (pI)

41.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	287
AciI	CCGC	3 cut(s)	62, 285, 287
AclWI	GGATC	6 cut(s)	12, 233, 246, 284, 297, 506
AcoI	YGGCCR	2 cut(s)	50, 446
AfaI	GTAC	1 cut(s)	591
AfiI	CCNNNNNNNGG	1 cut(s)	694
AgsI	TTSAA	2 cut(s)	142, 263
AluBI	AGCT	6 cut(s)	56, 335, 348, 385, 416, 478
AluI	AGCT	6 cut(s)	56, 335, 348, 385, 416, 478
AlwI	GGATC	6 cut(s)	12, 233, 246, 284, 297, 506
AoxI	GGCC	2 cut(s)	50, 446
ApeKI	GCWGC	2 cut(s)	416, 553
AspS9I	GGNCC	2 cut(s)	59, 430
AsuHPI	GGTGA	1 cut(s)	649
AvaII	GGWCC	2 cut(s)	59, 430
BaeGI	GKGCMC	1 cut(s)	210
BalI	TGGCCA	1 cut(s)	52
BamHI	GGATCC	3 cut(s)	4, 238, 289
BbsI	GAAGAC	1 cut(s)	5
BbvI	GCAGC	2 cut(s)	403, 540
BccI	CCATC	1 cut(s)	218
BceAI	ACGGC	1 cut(s)	461
BclI	TGATCA	2 cut(s)	87, 325
BfaI	CTAG	1 cut(s)	689
BisI	GCNGC	2 cut(s)	417, 554
BlsI	GCNGC	2 cut(s)	418, 555
Bme18I	GGWCC	2 cut(s)	59, 430
BmgT120I	GGNCC	2 cut(s)	59, 430
BmiI	GGNNCC	3 cut(s)	6, 240, 291
BmsI	GCATC	4 cut(s)	41, 290, 360, 540
BoxI	GACNNNNGTC	1 cut(s)	660
BpiI	GAAGAC	1 cut(s)	5
BpmI	CTGGAG	1 cut(s)	689
BpuEI	CTTGAG	1 cut(s)	512
BsaJI	CCNNGG	3 cut(s)	47, 285, 567
Bsc4I	CCNNNNNNNGG	1 cut(s)	694
Bse1I	ACTGG	1 cut(s)	382
Bse3DI	GCAATG	2 cut(s)	597, 623
BseDI	CCNNGG	3 cut(s)	47, 285, 567
BseGI	GGATG	2 cut(s)	281, 469
BseLI	CCNNNNNNNGG	1 cut(s)	694
BseMI	GCAATG	2 cut(s)	597, 623
BseMII	CTCAG	2 cut(s)	474, 549
BseNI	ACTGG	1 cut(s)	382
BseSI	GKGCMC	1 cut(s)	210
BseXI	GCAGC	2 cut(s)	403, 540
BseYI	CCCAGC	1 cut(s)	71
Bsh1236I	CGCG	1 cut(s)	287
BshFI	GGCC	2 cut(s)	52, 448
BslFI	GGGAC	1 cut(s)	670
BslI	CCNNNNNNNGG	1 cut(s)	694
BsmFI	GGGAC	1 cut(s)	670
BsnI	GGCC	2 cut(s)	52, 448
Bsp1286I	GDGCHC	1 cut(s)	210
Bsp143I	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
BspACI	CCGC	3 cut(s)	62, 285, 287
BspANI	GGCC	2 cut(s)	52, 448
BspCNI	CTCAG	2 cut(s)	475, 548
BspFNI	CGCG	1 cut(s)	287
BspLI	GGNNCC	3 cut(s)	6, 240, 291
BspPI	GGATC	6 cut(s)	12, 233, 246, 284, 297, 506
BsrDI	GCAATG	2 cut(s)	597, 623
BsrI	ACTGG	1 cut(s)	382
BssECI	CCNNGG	3 cut(s)	47, 285, 567
BssMI	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
BssT1I	CCWWGG	1 cut(s)	567
BstC8I	GCNNGC	3 cut(s)	54, 317, 503
BstDEI	CTNAG	3 cut(s)	17, 483, 535
BstDSI	CCRYGG	2 cut(s)	47, 285
BstENI	CCTNNNNNAGG	1 cut(s)	692
BstF5I	GGATG	2 cut(s)	281, 469
BstFNI	CGCG	1 cut(s)	287
BstKTI	GATC	6 cut(s)	7, 90, 241, 292, 328, 514
BstMBI	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
BstPAI	GACNNNNGTC	1 cut(s)	660
BstSLI	GKGCMC	1 cut(s)	210
BstUI	CGCG	1 cut(s)	287
BstV1I	GCAGC	2 cut(s)	403, 540
BstV2I	GAAGAC	1 cut(s)	5
BstX2I	RGATCY	4 cut(s)	4, 238, 289, 511
BstYI	RGATCY	4 cut(s)	4, 238, 289, 511
BsuRI	GGCC	2 cut(s)	52, 448
BtgI	CCRYGG	2 cut(s)	47, 285
BtsCI	GGATG	2 cut(s)	281, 469
Cac8I	GCNNGC	3 cut(s)	54, 317, 503
Cfr13I	GGNCC	2 cut(s)	59, 430
Cfr42I	CCGCGG	1 cut(s)	288
CseI	GACGC	2 cut(s)	198, 665
Csp6I	GTAC	1 cut(s)	590
CspCI	CAANNNNNGTGG	2 cut(s)	130, 165
CviQI	GTAC	1 cut(s)	590
DdeI	CTNAG	3 cut(s)	17, 483, 535
DpnI	GATC	6 cut(s)	6, 89, 240, 291, 327, 513
DpnII	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
EaeI	YGGCCR	2 cut(s)	50, 446
Eco130I	CCWWGG	1 cut(s)	567
Eco47I	GGWCC	2 cut(s)	59, 430
EcoNI	CCTNNNNNAGG	1 cut(s)	692
EcoT14I	CCWWGG	1 cut(s)	567
ErhI	CCWWGG	1 cut(s)	567
FaqI	GGGAC	1 cut(s)	670
FauNDI	CATATG	2 cut(s)	322, 391
FbaI	TGATCA	2 cut(s)	87, 325
Fnu4HI	GCNGC	2 cut(s)	417, 554
FokI	GGATG	2 cut(s)	268, 456
Fsp4HI	GCNGC	2 cut(s)	417, 554
FspBI	CTAG	1 cut(s)	689
GluI	GCNGC	2 cut(s)	417, 554
GsaI	CCCAGC	1 cut(s)	75
GsuI	CTGGAG	1 cut(s)	689
HaeIII	GGCC	2 cut(s)	52, 448
HgaI	GACGC	2 cut(s)	198, 665
HincII	GTYRAC	1 cut(s)	271
HindII	GTYRAC	1 cut(s)	271
HindIII	AAGCTT	2 cut(s)	383, 476
HinfI	GANTC	1 cut(s)	161
HphI	GGTGA	1 cut(s)	649
Hpy166II	GTNNAC	4 cut(s)	188, 271, 433, 592
Hpy188I	TCNGA	3 cut(s)	92, 223, 538
Hpy188III	TCNNGA	2 cut(s)	36, 668
Hpy8I	GTNNAC	4 cut(s)	188, 271, 433, 592
Hpy99I	CGWCG	1 cut(s)	659
HpyAV	CCTTC	1 cut(s)	637
HpyCH4V	TGCA	3 cut(s)	171, 353, 556
HpyF3I	CTNAG	3 cut(s)	17, 483, 535
Ksp22I	TGATCA	2 cut(s)	87, 325
KspI	CCGCGG	1 cut(s)	288
Kzo9I	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
LpnPI	CCDG	9 cut(s)	42, 42, 66, 85, 186, 363, 487, 565, 653
Lsp1109I	GCAGC	2 cut(s)	403, 540
LweI	GCATC	4 cut(s)	41, 290, 360, 540
MaeI	CTAG	1 cut(s)	689
MaeIII	GTNAC	1 cut(s)	486
MalI	GATC	6 cut(s)	6, 89, 240, 291, 327, 513
MboI	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
MboII	GAAGA	4 cut(s)	5, 35, 275, 661
MfeI	CAATTG	1 cut(s)	354
MflI	RGATCY	4 cut(s)	4, 238, 289, 511
MhlI	GDGCHC	1 cut(s)	210
MlsI	TGGCCA	1 cut(s)	52
MluCI	AATT	4 cut(s)	107, 143, 354, 632
MluNI	TGGCCA	1 cut(s)	52
MmeI	TCCRAC	3 cut(s)	160, 403, 539
MnlI	CCTC	6 cut(s)	90, 176, 221, 565, 664, 688
Mox20I	TGGCCA	1 cut(s)	52
MscI	TGGCCA	1 cut(s)	52
MseI	TTAA	4 cut(s)	146, 212, 521, 618
MslI	CAYNNNNRTG	1 cut(s)	548
Msp20I	TGGCCA	1 cut(s)	52
MspA1I	CMGCKG	2 cut(s)	56, 287
MunI	CAATTG	1 cut(s)	354
MvnI	CGCG	1 cut(s)	287
NdeI	CATATG	2 cut(s)	322, 391
NdeII	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
NlaIV	GGNNCC	3 cut(s)	6, 240, 291
PfeI	GAWTC	1 cut(s)	161
PflFI	GACNNNGTC	1 cut(s)	695
PkrI	GCNGC	2 cut(s)	418, 555
PshAI	GACNNNNGTC	1 cut(s)	660
PspFI	CCCAGC	1 cut(s)	71
PspN4I	GGNNCC	3 cut(s)	6, 240, 291
PspPI	GGNCC	2 cut(s)	59, 430
PsuI	RGATCY	4 cut(s)	4, 238, 289, 511
PsyI	GACNNNGTC	1 cut(s)	695
PvuII	CAGCTG	1 cut(s)	56
RsaI	GTAC	1 cut(s)	591
RsaNI	GTAC	1 cut(s)	590
RseI	CAYNNNNRTG	1 cut(s)	548
SacII	CCGCGG	1 cut(s)	288
SaqAI	TTAA	4 cut(s)	146, 212, 521, 618
SatI	GCNGC	2 cut(s)	417, 554
Sau3AI	GATC	6 cut(s)	4, 87, 238, 289, 325, 511
Sau96I	GGNCC	2 cut(s)	59, 430
SduI	GDGCHC	1 cut(s)	210
SetI	ASST	9 cut(s)	58, 187, 337, 350, 387, 418, 480, 576, 699
SfaNI	GCATC	4 cut(s)	41, 290, 360, 540
Sfr303I	CCGCGG	1 cut(s)	288
SgrBI	CCGCGG	1 cut(s)	288
SinI	GGWCC	2 cut(s)	59, 430
SmiMI	CAYNNNNRTG	1 cut(s)	548
SmlI	CTYRAG	1 cut(s)	491
SmoI	CTYRAG	1 cut(s)	491
Sse9I	AATT	4 cut(s)	107, 143, 354, 632
SsiI	CCGC	3 cut(s)	62, 285, 287
SspMI	CTAG	1 cut(s)	689
StyI	CCWWGG	1 cut(s)	567
TaqI	TCGA	1 cut(s)	37
TasI	AATT	4 cut(s)	107, 143, 354, 632
TfiI	GAWTC	1 cut(s)	161
Tru1I	TTAA	4 cut(s)	146, 212, 521, 618
Tru9I	TTAA	4 cut(s)	146, 212, 521, 618
TseI	GCWGC	2 cut(s)	416, 553
TspDTI	ATGAA	2 cut(s)	408, 656
TspGWI	ACGGA	2 cut(s)	36, 672
Tth111I	GACNNNGTC	1 cut(s)	695
VpaK11BI	GGWCC	2 cut(s)	59, 430
XagI	CCTNNNNNAGG	1 cut(s)	692
XspI	CTAG	1 cut(s)	689

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.