Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0016837.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

333 .. 788

Gene Structure 456 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0016837.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 456 bp

atgtatcgatcccaggcaaaggaacttaacctatggaaattggaaaaagaatataaattagaagaggcacgattagctgaggaaatggcattgaaactagtggagaaagagaaagcaaaatgtaaggcagctatcaaggaagcagaagcagctcaaagggttgccaaattggaagcacaaagagcaaggattgcagaaatggaagctctgaaacaagcagaggcgaagaaggtatcagaagcaatgacatatgatctaaggtacaggaaatacacaattgaggagcttgaagcagcaacaaatggtttttcacaagcttgcaaaattggtgaaggaggctatgggccagtatacctgggtgaaatagaccatacacgagtggcaataaaagttctgcgtcctgatgcagctcaaggacggttgcagttccagaaagaggtttgtgactttctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr Usp

Protein Analysis

151

Amino Acids

17.22

Weight (kDa)

8.33

Isoelectric Point (pI)

30.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	351
AclWI	GGATC	1 cut(s)	3
AfaI	GTAC	1 cut(s)	263
AfiI	CCNNNNNNNGG	2 cut(s)	19, 436
AgsI	TTSAA	2 cut(s)	94, 290
AhlI	ACTAGT	1 cut(s)	97
AjnI	CCWGG	2 cut(s)	12, 354
AluBI	AGCT	7 cut(s)	77, 131, 152, 206, 286, 317, 410
AluI	AGCT	7 cut(s)	77, 131, 152, 206, 286, 317, 410
AlwI	GGATC	1 cut(s)	3
AoxI	GGCC	1 cut(s)	344
ApeKI	GCWGC	4 cut(s)	128, 149, 293, 407
AspS9I	GGNCC	1 cut(s)	344
AsuHPI	GGTGA	2 cut(s)	341, 371
BauI	CACGAG	1 cut(s)	375
BbvCI	CCTCAGC	1 cut(s)	78
BbvI	GCAGC	4 cut(s)	140, 161, 305, 419
BciT130I	CCWGG	2 cut(s)	14, 356
BcuI	ACTAGT	1 cut(s)	97
BfaI	CTAG	1 cut(s)	98
BisI	GCNGC	4 cut(s)	129, 150, 294, 408
BlsI	GCNGC	4 cut(s)	130, 151, 295, 409
Bme1390I	CCNGG	2 cut(s)	14, 356
BmgT120I	GGNCC	1 cut(s)	344
BmrFI	CCNGG	2 cut(s)	14, 356
BmsI	GCATC	1 cut(s)	394
Bpu10I	CCTNAGC	1 cut(s)	78
BpuEI	CTTGAG	1 cut(s)	396
Bsa29I	ATCGAT	1 cut(s)	7
BsaJI	CCNNGG	2 cut(s)	12, 355
Bsc4I	CCNNNNNNNGG	2 cut(s)	19, 436
Bse1I	ACTGG	1 cut(s)	347
Bse3DI	GCAATG	1 cut(s)	249
BseBI	CCWGG	2 cut(s)	14, 356
BseCI	ATCGAT	1 cut(s)	7
BseDI	CCNNGG	2 cut(s)	12, 355
BseLI	CCNNNNNNNGG	2 cut(s)	19, 436
BseMI	GCAATG	1 cut(s)	249
BseMII	CTCAG	1 cut(s)	69
BseNI	ACTGG	1 cut(s)	347
BseRI	GAGGAG	1 cut(s)	296
BseXI	GCAGC	4 cut(s)	140, 161, 305, 419
BshFI	GGCC	1 cut(s)	346
BshVI	ATCGAT	1 cut(s)	7
BslI	CCNNNNNNNGG	2 cut(s)	19, 436
BsnI	GGCC	1 cut(s)	346
Bsp143I	GATC	2 cut(s)	8, 253
BspANI	GGCC	1 cut(s)	346
BspCNI	CTCAG	1 cut(s)	70
BspDI	ATCGAT	1 cut(s)	7
BspPI	GGATC	1 cut(s)	3
BsrDI	GCAATG	1 cut(s)	249
BsrI	ACTGG	1 cut(s)	347
BssECI	CCNNGG	2 cut(s)	12, 355
BssMI	GATC	2 cut(s)	8, 253
BssNAI	GTATAC	1 cut(s)	352
BssSI	CACGAG	1 cut(s)	375
Bst1107I	GTATAC	1 cut(s)	352
Bst2BI	CACGAG	1 cut(s)	375
Bst2UI	CCWGG	2 cut(s)	14, 356
Bst4CI	ACNGT	1 cut(s)	420
Bst6I	CTCTTC	1 cut(s)	57
BstAPI	GCANNNNNTGC	1 cut(s)	191
BstC8I	GCNNGC	1 cut(s)	319
BstDEI	CTNAG	2 cut(s)	78, 257
BstKTI	GATC	2 cut(s)	11, 256
BstMBI	GATC	2 cut(s)	8, 253
BstMWI	GCNNNNNNNGC	4 cut(s)	74, 149, 182, 191
BstNI	CCWGG	2 cut(s)	14, 356
BstSCI	CCNGG	2 cut(s)	12, 354
BstV1I	GCAGC	4 cut(s)	140, 161, 305, 419
BstZ17I	GTATAC	1 cut(s)	352
Bsu15I	ATCGAT	1 cut(s)	7
BsuRI	GGCC	1 cut(s)	346
BsuTUI	ATCGAT	1 cut(s)	7
Cac8I	GCNNGC	1 cut(s)	319
Cfr13I	GGNCC	1 cut(s)	344
ClaI	ATCGAT	1 cut(s)	7
CseI	GACGC	1 cut(s)	386
Csp6I	GTAC	1 cut(s)	262
CviJI	RGCY	9 cut(s)	77, 131, 152, 206, 286, 317, 339, 346, 410
CviKI_1	RGCY	9 cut(s)	77, 131, 152, 206, 286, 317, 339, 346, 410
CviQI	GTAC	1 cut(s)	262
DdeI	CTNAG	2 cut(s)	78, 257
DpnI	GATC	2 cut(s)	10, 255
DpnII	GATC	2 cut(s)	8, 253
Eam1104I	CTCTTC	1 cut(s)	57
EarI	CTCTTC	1 cut(s)	57
EcoRII	CCWGG	2 cut(s)	12, 354
FaiI	YATR	7 cut(s)	34, 54, 250, 252, 342, 352, 372
FauNDI	CATATG	1 cut(s)	250
FblI	GTMKAC	1 cut(s)	351
Fnu4HI	GCNGC	4 cut(s)	129, 150, 294, 408
Fsp4HI	GCNGC	4 cut(s)	129, 150, 294, 408
FspBI	CTAG	1 cut(s)	98
GluI	GCNGC	4 cut(s)	129, 150, 294, 408
HaeIII	GGCC	1 cut(s)	346
HgaI	GACGC	1 cut(s)	386
HindIII	AAGCTT	1 cut(s)	315
HphI	GGTGA	2 cut(s)	341, 371
Hpy166II	GTNNAC	1 cut(s)	352
Hpy188I	TCNGA	2 cut(s)	210, 238
Hpy188III	TCNNGA	2 cut(s)	401, 430
Hpy8I	GTNNAC	1 cut(s)	352
HpyAV	CCTTC	2 cut(s)	223, 326
HpyCH4III	ACNGT	1 cut(s)	420
HpyCH4V	TGCA	4 cut(s)	194, 321, 407, 424
HpyF10VI	GCNNNNNNNGC	4 cut(s)	74, 149, 182, 191
HpyF3I	CTNAG	2 cut(s)	78, 257
Kzo9I	GATC	2 cut(s)	8, 253
LmnI	GCTCC	1 cut(s)	283
LpnPI	CCDG	7 cut(s)	26, 250, 341, 360, 368, 414, 443
Lsp1109I	GCAGC	4 cut(s)	140, 161, 305, 419
LweI	GCATC	1 cut(s)	394
MaeI	CTAG	1 cut(s)	98
MaeIII	GTNAC	1 cut(s)	443
MalI	GATC	2 cut(s)	10, 255
MboI	GATC	2 cut(s)	8, 253
MboII	GAAGA	2 cut(s)	74, 238
MfeI	CAATTG	1 cut(s)	276
MluCI	AATT	5 cut(s)	38, 56, 167, 276, 324
MnlI	CCTC	6 cut(s)	58, 73, 214, 274, 329, 430
MseI	TTAA	2 cut(s)	27, 454
MspR9I	CCNGG	2 cut(s)	14, 356
MunI	CAATTG	1 cut(s)	276
MvaI	CCWGG	2 cut(s)	14, 356
MwoI	GCNNNNNNNGC	4 cut(s)	74, 149, 182, 191
NdeI	CATATG	1 cut(s)	250
NdeII	GATC	2 cut(s)	8, 253
NmuCI	GTSAC	1 cut(s)	443
PkrI	GCNGC	4 cut(s)	130, 151, 295, 409
Psp6I	CCWGG	2 cut(s)	12, 354
PspGI	CCWGG	2 cut(s)	12, 354
PspPI	GGNCC	1 cut(s)	344
RsaI	GTAC	1 cut(s)	263
RsaNI	GTAC	1 cut(s)	262
SaqAI	TTAA	2 cut(s)	27, 454
SatI	GCNGC	4 cut(s)	129, 150, 294, 408
Sau3AI	GATC	2 cut(s)	8, 253
Sau96I	GGNCC	1 cut(s)	344
ScrFI	CCNGG	2 cut(s)	14, 356
SfaNI	GCATC	1 cut(s)	394
SmlI	CTYRAG	1 cut(s)	411
SmoI	CTYRAG	1 cut(s)	411
SpeI	ACTAGT	1 cut(s)	97
Sse9I	AATT	5 cut(s)	38, 56, 167, 276, 324
SspMI	CTAG	1 cut(s)	98
StyD4I	CCNGG	2 cut(s)	12, 354
TaaI	ACNGT	1 cut(s)	420
TaqI	TCGA	1 cut(s)	7
TasI	AATT	5 cut(s)	38, 56, 167, 276, 324
Tru1I	TTAA	2 cut(s)	27, 454
Tru9I	TTAA	2 cut(s)	27, 454
TseFI	GTSAC	1 cut(s)	443
TseI	GCWGC	4 cut(s)	128, 149, 293, 407
Tsp45I	GTSAC	1 cut(s)	443
XmiI	GTMKAC	1 cut(s)	351
XspI	CTAG	1 cut(s)	98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.