Rmu_sc0020487.1_g000001

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020487.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 660
659 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020487.1_g000001.1.cds

Sequence Viewer

Length: 659 bp
atggcattctggaatctcactaatcttcaaagtgtacagcttttctccaataacctcagtggcataatccgcccagagattgggaacatgacttcattgtctgtctttgatgtcaacacaaaccaatttgagggggagttgccagagaccatttctctcctcactaaccttgtgggcttttctgtattcaccaataagttgtccggaaatattcctagtgattttgggaagtatagtcctaacttgggatatcttagcttttcgaacaacagcttctctggagaattgccaccagagttgtgcagtggattttctttgcaacaattcacagtgaatgtcaacaacttcacagggccattacccgagtgcttgagaaattgtactgcattaaatagaatccggcttgatgagaaccagttcaccggaaatattaccaatgcatttggtgtccatcccagtcttgaagaaatttatcttagtcacaacaagtttgttggtgaactctcaccacattggggagagtgcataaacatcactgacatgcgtatggacggaaacagaatttctggtcaaattcctcctgagcttctgaagttgaagaacttgcagtatctaacactaggttctaatgaattcagtggggaatttccagttggtat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

219

Amino Acids

24.28

Weight (kDa)

4.72

Isoelectric Point (pI)

39.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 97
AccB7I CCANNNNNTGG 1 cut(s) 80
AccIII TCCGGA 1 cut(s) 203
AciI CCGC 1 cut(s) 70
AcsI RAATTY 5 cut(s) 468, 561, 573, 632, 644
AcuI CTGAAG 1 cut(s) 611
AfaI GTAC 2 cut(s) 36, 382
AfiI CCNNNNNNNGG 4 cut(s) 80, 130, 245, 515
AgsI TTSAA 3 cut(s) 29, 464, 598
AjuI GAANNNNNNNTTGG 1 cut(s) 636
AluBI AGCT 4 cut(s) 40, 258, 273, 586
AluI AGCT 4 cut(s) 40, 258, 273, 586
Alw26I GTCTC 1 cut(s) 140
Ama87I CYCGRG 1 cut(s) 362
Aor13HI TCCGGA 1 cut(s) 203
AoxI GGCC 1 cut(s) 353
ApoI RAATTY 5 cut(s) 468, 561, 573, 632, 644
Asp700I GAANNNNTTC 1 cut(s) 416
AspS9I GGNCC 1 cut(s) 353
AsuHPI GGTGA 4 cut(s) 181, 412, 498, 509
AsuII TTCGAA 1 cut(s) 263
AvaI CYCGRG 1 cut(s) 362
BccI CCATC 1 cut(s) 459
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 2 cut(s) 216, 620
BmeT110I CYCGRG 1 cut(s) 362
BmgT120I GGNCC 1 cut(s) 353
BmrI ACTGGG 1 cut(s) 450
BmuI ACTGGG 1 cut(s) 450
BpmI CTGGAG 1 cut(s) 300
Bpu10I CCTNAGC 1 cut(s) 582
Bpu14I TTCGAA 1 cut(s) 263
BpuEI CTTGAG 1 cut(s) 391
BsaI GGTCTC 1 cut(s) 140
BsaWI WCCGGW 2 cut(s) 203, 422
Bsc4I CCNNNNNNNGG 4 cut(s) 80, 130, 245, 515
Bse1I ACTGG 3 cut(s) 415, 456, 650
BseAI TCCGGA 1 cut(s) 203
BseGI GGATG 1 cut(s) 451
BseLI CCNNNNNNNGG 4 cut(s) 80, 130, 245, 515
BseMII CTCAG 2 cut(s) 70, 573
BseNI ACTGG 3 cut(s) 415, 456, 650
BseRI GAGGAG 1 cut(s) 149
BsgI GTGCAG 1 cut(s) 322
BshFI GGCC 1 cut(s) 355
BsiHKCI CYCGRG 1 cut(s) 362
BsiSI CCGG 3 cut(s) 204, 400, 423
BslI CCNNNNNNNGG 4 cut(s) 80, 130, 245, 515
BsmAI GTCTC 1 cut(s) 140
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 1 cut(s) 355
Bso31I GGTCTC 1 cut(s) 140
BsoBI CYCGRG 1 cut(s) 362
Bsp119I TTCGAA 1 cut(s) 263
Bsp13I TCCGGA 1 cut(s) 203
Bsp1407I TGTACA 1 cut(s) 34
BspACI CCGC 1 cut(s) 70
BspANI GGCC 1 cut(s) 355
BspCNI CTCAG 2 cut(s) 69, 574
BspEI TCCGGA 1 cut(s) 203
BspT104I TTCGAA 1 cut(s) 263
BspTNI GGTCTC 1 cut(s) 140
BsrGI TGTACA 1 cut(s) 34
BsrI ACTGG 3 cut(s) 415, 456, 650
Bst4CI ACNGT 1 cut(s) 331
BstAUI TGTACA 1 cut(s) 34
BstBI TTCGAA 1 cut(s) 263
BstDEI CTNAG 4 cut(s) 56, 254, 476, 582
BstF5I GGATG 1 cut(s) 451
BstMAI GTCTC 1 cut(s) 140
BstMWI GCNNNNNNNGC 1 cut(s) 69
BstNSI RCATGY 1 cut(s) 544
BsuRI GGCC 1 cut(s) 355
BtsCI GGATG 1 cut(s) 451
BtsI GCAGTG 1 cut(s) 310
BtsIMutI CAGTG 5 cut(s) 64, 310, 336, 534, 643
Cfr13I GGNCC 1 cut(s) 353
Csp6I GTAC 2 cut(s) 35, 381
CspCI CAANNNNNGTGG 2 cut(s) 279, 314
CviAII CATG 2 cut(s) 88, 541
CviJI RGCY 7 cut(s) 40, 177, 258, 273, 355, 403, 586
CviKI_1 RGCY 7 cut(s) 40, 177, 258, 273, 355, 403, 586
CviQI GTAC 2 cut(s) 35, 381
DdeI CTNAG 4 cut(s) 56, 254, 476, 582
DrdI GACNNNNNNGTC 1 cut(s) 97
DseDI GACNNNNNNGTC 1 cut(s) 97
EciI GGCGGA 1 cut(s) 59
Eco31I GGTCTC 1 cut(s) 140
Eco32I GATATC 1 cut(s) 251
Eco57I CTGAAG 1 cut(s) 611
Eco88I CYCGRG 1 cut(s) 362
EcoRI GAATTC 1 cut(s) 632
EcoRV GATATC 1 cut(s) 251
EcoT22I ATGCAT 1 cut(s) 442
FaeI CATG 2 cut(s) 91, 544
FaiI YATR 6 cut(s) 65, 89, 234, 527, 542, 548
FatI CATG 2 cut(s) 87, 540
FokI GGATG 1 cut(s) 438
FspBI CTAG 2 cut(s) 216, 620
GsuI CTGGAG 1 cut(s) 300
HaeIII GGCC 1 cut(s) 355
HapII CCGG 3 cut(s) 204, 400, 423
Hin1II CATG 2 cut(s) 91, 544
HincII GTYRAC 2 cut(s) 115, 340
HindII GTYRAC 2 cut(s) 115, 340
HinfI GANTC 2 cut(s) 13, 396
HpaII CCGG 3 cut(s) 204, 400, 423
HphI GGTGA 4 cut(s) 181, 412, 498, 509
Hpy166II GTNNAC 5 cut(s) 35, 115, 340, 420, 500
Hpy188I TCNGA 1 cut(s) 591
Hpy188III TCNNGA 5 cut(s) 10, 204, 279, 461, 581
Hpy8I GTNNAC 5 cut(s) 35, 115, 340, 420, 500
HpyCH4III ACNGT 1 cut(s) 331
HpyCH4V TGCA 6 cut(s) 303, 319, 386, 440, 525, 607
HpyF10VI GCNNNNNNNGC 1 cut(s) 69
HpyF3I CTNAG 4 cut(s) 56, 254, 476, 582
Hsp92II CATG 2 cut(s) 91, 544
Kpn2I TCCGGA 1 cut(s) 203
MaeI CTAG 2 cut(s) 216, 620
MaeIII GTNAC 1 cut(s) 479
MboII GAAGA 3 cut(s) 17, 476, 610
MluCI AATT 9 cut(s) 125, 284, 323, 376, 468, 561, 573, 632, 644
MnlI CCTC 4 cut(s) 65, 124, 170, 588
Mph1103I ATGCAT 1 cut(s) 442
MroI TCCGGA 1 cut(s) 203
MroXI GAANNNNTTC 1 cut(s) 416
MseI TTAA 1 cut(s) 389
MslI CAYNNNNRTG 2 cut(s) 539, 545
MspI CCGG 3 cut(s) 204, 400, 423
Mva1269I GAATGC 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 69
NlaIII CATG 2 cut(s) 91, 544
NmuCI GTSAC 1 cut(s) 479
NsiI ATGCAT 1 cut(s) 442
NspI RCATGY 1 cut(s) 544
NspV TTCGAA 1 cut(s) 263
PctI GAATGC 1 cut(s) 5
PdmI GAANNNNTTC 1 cut(s) 416
PfeI GAWTC 2 cut(s) 13, 396
PflMI CCANNNNNTGG 1 cut(s) 80
PspPI GGNCC 1 cut(s) 353
RsaI GTAC 2 cut(s) 36, 382
RsaNI GTAC 2 cut(s) 35, 381
RseI CAYNNNNRTG 2 cut(s) 539, 545
SaqAI TTAA 1 cut(s) 389
Sau96I GGNCC 1 cut(s) 353
SetI ASST 7 cut(s) 42, 57, 171, 260, 275, 588, 625
SfuI TTCGAA 1 cut(s) 263
SmiMI CAYNNNNRTG 2 cut(s) 539, 545
SmlI CTYRAG 1 cut(s) 370
SmoI CTYRAG 1 cut(s) 370
Sse9I AATT 9 cut(s) 125, 284, 323, 376, 468, 561, 573, 632, 644
SsiI CCGC 1 cut(s) 70
SspI AATATT 2 cut(s) 211, 430
SspMI CTAG 2 cut(s) 216, 620
TaaI ACNGT 1 cut(s) 331
TaqI TCGA 1 cut(s) 263
TasI AATT 9 cut(s) 125, 284, 323, 376, 468, 561, 573, 632, 644
TatI WGTACW 2 cut(s) 34, 380
TfiI GAWTC 2 cut(s) 13, 396
Tru1I TTAA 1 cut(s) 389
Tru9I TTAA 1 cut(s) 389
TscAI CASTG 5 cut(s) 64, 310, 336, 541, 643
TseFI GTSAC 1 cut(s) 479
Tsp45I GTSAC 1 cut(s) 479
TspDTI ATGAA 2 cut(s) 84, 645
TspGWI ACGGA 1 cut(s) 567
TspRI CASTG 5 cut(s) 64, 310, 336, 541, 643
Van91I CCANNNNNTGG 1 cut(s) 80
XapI RAATTY 5 cut(s) 468, 561, 573, 632, 644
XceI RCATGY 1 cut(s) 544
XmnI GAANNNNTTC 1 cut(s) 416
XspI CTAG 2 cut(s) 216, 620
Zsp2I ATGCAT 1 cut(s) 442
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.