Rmu_sc0021068.1_g000003

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021068.1
N/A
Physical Location & Seq
Forward (+)
5176 .. 6177
1002 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021068.1_g000003.1.cds

Sequence Viewer

Length: 612 bp
atgttaatgtggttcgattggttggattctgtgcggatggattcagacactcctgtttatgacttcttatctaatgggtcactacaagatttcattttatcaacagacaataacaattctttccttggttgcgatgagttgcaagatattgctctacgaatagcaaaaggaattgaatatctgcaccaaggatgcaatcaacgaatcctacattttgatatcaaaccccataatgttttactagaccataacttcaatgcaaagatttctgattttggtttggccaagttatgttccaagaatcaaagtatagtgtcaatgactacagctaggggaacgatggggtacatcgcgcctgaagttcggaaagatgggctaggagaacgatggggtacatcgcgcctgaagttcggaaagatggggtgcatctccaggaacttcggaaatgtgtcctataagtcagatttctatagttatggaatgtcactgcttgagatggtaggagggagaaagaatattggttcaaccacagagaacaccaatgaagtttactacccagaacggatctataatcatctagaaggagatggcctacctaccccatatggctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

22.97

Weight (kDa)

5.71

Isoelectric Point (pI)

34.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 353, 400
AciI CCGC 1 cut(s) 34
AclWI GGATC 1 cut(s) 572
AcoI YGGCCR 1 cut(s) 282
AcuI CTGAAG 2 cut(s) 378, 425
AfaI GTAC 2 cut(s) 347, 394
AgsI TTSAA 3 cut(s) 176, 256, 525
AjnI CCWGG 1 cut(s) 431
AluBI AGCT 1 cut(s) 329
AluI AGCT 1 cut(s) 329
AlwI GGATC 1 cut(s) 572
AoxI GGCC 2 cut(s) 282, 589
AspLEI GCGC 2 cut(s) 355, 402
BalI TGGCCA 1 cut(s) 284
BccI CCATC 7 cut(s) 31, 334, 365, 381, 412, 490, 581
BciT130I CCWGG 1 cut(s) 433
BfaI CTAG 4 cut(s) 242, 330, 377, 578
BfmI CTRYAG 2 cut(s) 324, 469
Bme1390I CCNGG 1 cut(s) 433
BmrFI CCNGG 1 cut(s) 433
BmsI GCATC 2 cut(s) 182, 435
BpmI CTGGAG 1 cut(s) 415
BpuEI CTTGAG 1 cut(s) 512
BsaJI CCNNGG 2 cut(s) 124, 187
BseBI CCWGG 1 cut(s) 433
BseDI CCNNGG 2 cut(s) 124, 187
BseGI GGATG 2 cut(s) 42, 197
BsgI GTGCAG 1 cut(s) 167
Bsh1236I CGCG 2 cut(s) 353, 400
BshFI GGCC 2 cut(s) 284, 591
BsnI GGCC 2 cut(s) 284, 591
Bsp143I GATC 1 cut(s) 564
BspACI CCGC 1 cut(s) 34
BspANI GGCC 2 cut(s) 284, 591
BspFNI CGCG 2 cut(s) 353, 400
BspPI GGATC 1 cut(s) 572
BssECI CCNNGG 2 cut(s) 124, 187
BssMI GATC 1 cut(s) 564
BssT1I CCWWGG 2 cut(s) 124, 187
Bst2UI CCWGG 1 cut(s) 433
BstF5I GGATG 2 cut(s) 42, 197
BstFNI CGCG 2 cut(s) 353, 400
BstHHI GCGC 2 cut(s) 355, 402
BstKTI GATC 1 cut(s) 567
BstMBI GATC 1 cut(s) 564
BstNI CCWGG 1 cut(s) 433
BstSCI CCNGG 1 cut(s) 431
BstSFI CTRYAG 2 cut(s) 324, 469
BstUI CGCG 2 cut(s) 353, 400
BstX2I RGATCY 1 cut(s) 564
BstYI RGATCY 1 cut(s) 564
BsuRI GGCC 2 cut(s) 284, 591
BtgZI GCGATG 3 cut(s) 147, 334, 381
BtsCI GGATG 2 cut(s) 42, 197
BtsI GCAGTG 1 cut(s) 485
BtsIMutI CAGTG 1 cut(s) 485
CfoI GCGC 2 cut(s) 355, 402
Csp6I GTAC 2 cut(s) 346, 393
CviJI RGCY 5 cut(s) 284, 329, 376, 591, 609
CviKI_1 RGCY 5 cut(s) 284, 329, 376, 591, 609
CviQI GTAC 2 cut(s) 346, 393
DpnI GATC 1 cut(s) 566
DpnII GATC 1 cut(s) 564
EaeI YGGCCR 1 cut(s) 282
Eco130I CCWWGG 2 cut(s) 124, 187
Eco32I GATATC 1 cut(s) 220
Eco57I CTGAAG 2 cut(s) 378, 425
EcoRII CCWGG 1 cut(s) 431
EcoRV GATATC 1 cut(s) 220
EcoT14I CCWWGG 2 cut(s) 124, 187
ErhI CCWWGG 2 cut(s) 124, 187
FauNDI CATATG 1 cut(s) 604
FokI GGATG 2 cut(s) 49, 204
FspBI CTAG 4 cut(s) 242, 330, 377, 578
GlaI GCGC 2 cut(s) 354, 401
GsuI CTGGAG 1 cut(s) 415
HaeIII GGCC 2 cut(s) 284, 591
HhaI GCGC 2 cut(s) 355, 402
Hin6I GCGC 2 cut(s) 353, 400
HinP1I GCGC 2 cut(s) 353, 400
HinfI GANTC 4 cut(s) 26, 41, 204, 301
Hpy166II GTNNAC 1 cut(s) 550
Hpy188I TCNGA 6 cut(s) 46, 271, 366, 413, 443, 463
Hpy188III TCNNGA 1 cut(s) 578
Hpy8I GTNNAC 1 cut(s) 550
HpyAV CCTTC 1 cut(s) 575
HpyCH4V TGCA 5 cut(s) 142, 184, 195, 260, 426
HspAI GCGC 2 cut(s) 353, 400
Kzo9I GATC 1 cut(s) 564
LpnPI CCDG 6 cut(s) 66, 369, 416, 418, 445, 570
LweI GCATC 2 cut(s) 182, 435
MaeI CTAG 4 cut(s) 242, 330, 377, 578
MaeIII GTNAC 2 cut(s) 78, 483
MalI GATC 1 cut(s) 566
MboI GATC 1 cut(s) 564
MflI RGATCY 1 cut(s) 564
MlsI TGGCCA 1 cut(s) 284
MluCI AATT 2 cut(s) 115, 171
MluNI TGGCCA 1 cut(s) 284
MnlI CCTC 1 cut(s) 497
Mox20I TGGCCA 1 cut(s) 284
MscI TGGCCA 1 cut(s) 284
MseI TTAA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 284
MspR9I CCNGG 1 cut(s) 433
MvaI CCWGG 1 cut(s) 433
MvnI CGCG 2 cut(s) 353, 400
NdeI CATATG 1 cut(s) 604
NdeII GATC 1 cut(s) 564
NmuCI GTSAC 2 cut(s) 78, 483
PfeI GAWTC 4 cut(s) 26, 41, 204, 301
PfoI TCCNGGA 1 cut(s) 431
Psp6I CCWGG 1 cut(s) 431
PspGI CCWGG 1 cut(s) 431
PsuI RGATCY 1 cut(s) 564
RsaI GTAC 2 cut(s) 347, 394
RsaNI GTAC 2 cut(s) 346, 393
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 1 cut(s) 564
ScrFI CCNGG 1 cut(s) 433
SetI ASST 2 cut(s) 331, 598
SfaNI GCATC 2 cut(s) 182, 435
SfcI CTRYAG 2 cut(s) 324, 469
SmlI CTYRAG 1 cut(s) 491
SmoI CTYRAG 1 cut(s) 491
Sse9I AATT 2 cut(s) 115, 171
SsiI CCGC 1 cut(s) 34
SspI AATATT 1 cut(s) 517
SspMI CTAG 4 cut(s) 242, 330, 377, 578
StyD4I CCNGG 1 cut(s) 431
StyI CCWWGG 2 cut(s) 124, 187
TaqI TCGA 1 cut(s) 15
TasI AATT 2 cut(s) 115, 171
TfiI GAWTC 4 cut(s) 26, 41, 204, 301
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TscAI CASTG 1 cut(s) 492
TseFI GTSAC 2 cut(s) 78, 483
Tsp45I GTSAC 2 cut(s) 78, 483
TspDTI ATGAA 2 cut(s) 82, 558
TspGWI ACGGA 1 cut(s) 577
TspRI CASTG 1 cut(s) 492
XbaI TCTAGA 1 cut(s) 577
XspI CTAG 4 cut(s) 242, 330, 377, 578
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.