Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028219.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

4146 .. 5005

Gene Structure 860 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028219.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 225 bp

atgtccaccgaggcagagccgtcgtcgtcgtcgtcgtcgacgtcggggttcatgaccgacggccctgatgacgtggaagactacatttcggctaatgaaggagaaccggcattgccctgggacatatttagtcatgtttttgatcttgtgcagaagggaaaccaggcttttcgagagaaccgattcgaggaggtgacattttggcattttatccagaatatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0003674 GO:0003824 GO:0004672 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009653 GO:0009705 GO:0009888 GO:0009987 GO:0010015 GO:0010053 GO:0010054 GO:0010959 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0019725 GO:0021700 GO:0022622 GO:0030154 GO:0031090 GO:0032501 GO:0032502 GO:0032879 GO:0036211 GO:0042592 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043269 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0048364 GO:0048468 GO:0048469 GO:0048731 GO:0048764 GO:0048765 GO:0048856 GO:0048869 GO:0048878 GO:0050789 GO:0051049 GO:0051924 GO:0055082 GO:0065007 GO:0065008 GO:0071695 GO:0071704 GO:0080147 GO:0090558 GO:0090627 GO:0097272 GO:0097275 GO:0098588 GO:0098805 GO:0099402 GO:0140096 GO:1901564 GO:1905392

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LON_substr_bdg Malectin_like Pkinase_Tyr zf-C3HC4_2

Protein Analysis

74

Amino Acids

8.38

Weight (kDa)

4.05

Isoelectric Point (pI)

55.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	44
AccI	GTMKAC	1 cut(s)	38
AcyI	GRCGYC	1 cut(s)	41
AfiI	CCNNNNNNNGG	1 cut(s)	187
AjiI	CACGTC	1 cut(s)	73
AjnI	CCWGG	2 cut(s)	116, 162
AoxI	GGCC	1 cut(s)	61
Asp700I	GAANNNNTTC	1 cut(s)	182
AspS9I	GGNCC	1 cut(s)	62
AsuHPI	GGTGA	1 cut(s)	205
BbsI	GAAGAC	1 cut(s)	84
BceAI	ACGGC	2 cut(s)	4, 76
BcgI	CGANNNNNNTGC	1 cut(s)	37
BciT130I	CCWGG	2 cut(s)	118, 164
Bme1390I	CCNGG	2 cut(s)	118, 164
BmgBI	CACGTC	1 cut(s)	73
BmgT120I	GGNCC	1 cut(s)	62
BmrFI	CCNGG	2 cut(s)	118, 164
BpiI	GAAGAC	1 cut(s)	84
BsaHI	GRCGYC	1 cut(s)	41
BsaJI	CCNNGG	3 cut(s)	9, 116, 117
Bsc4I	CCNNNNNNNGG	1 cut(s)	187
Bse118I	RCCGGY	1 cut(s)	106
Bse3DI	GCAATG	1 cut(s)	110
BseBI	CCWGG	2 cut(s)	118, 164
BseDI	CCNNGG	3 cut(s)	9, 116, 117
BseLI	CCNNNNNNNGG	1 cut(s)	187
BseMI	GCAATG	1 cut(s)	110
BseRI	GAGGAG	1 cut(s)	203
BsgI	GTGCAG	1 cut(s)	170
BshFI	GGCC	1 cut(s)	63
BsiSI	CCGG	1 cut(s)	107
BslFI	GGGAC	1 cut(s)	134
BslI	CCNNNNNNNGG	1 cut(s)	187
BsmFI	GGGAC	1 cut(s)	134
BsnI	GGCC	1 cut(s)	63
Bsp143I	GATC	1 cut(s)	142
BspANI	GGCC	1 cut(s)	63
BspHI	TCATGA	1 cut(s)	51
BsrDI	GCAATG	1 cut(s)	110
BsrFI	RCCGGY	1 cut(s)	106
BssAI	RCCGGY	1 cut(s)	106
BssECI	CCNNGG	3 cut(s)	9, 116, 117
BssMI	GATC	1 cut(s)	142
BssNI	GRCGYC	1 cut(s)	41
Bst2UI	CCWGG	2 cut(s)	118, 164
BstACI	GRCGYC	1 cut(s)	41
BstKTI	GATC	1 cut(s)	145
BstMBI	GATC	1 cut(s)	142
BstNI	CCWGG	2 cut(s)	118, 164
BstSCI	CCNGG	2 cut(s)	116, 162
BstV2I	GAAGAC	1 cut(s)	84
BsuRI	GGCC	1 cut(s)	63
BtrI	CACGTC	1 cut(s)	73
CciI	TCATGA	1 cut(s)	51
Cfr10I	RCCGGY	1 cut(s)	106
Cfr13I	GGNCC	1 cut(s)	62
CviAII	CATG	2 cut(s)	52, 134
CviJI	RGCY	4 cut(s)	19, 63, 92, 167
CviKI_1	RGCY	4 cut(s)	19, 63, 92, 167
DpnI	GATC	1 cut(s)	144
DpnII	GATC	1 cut(s)	142
EcoRII	CCWGG	2 cut(s)	116, 162
FaeI	CATG	2 cut(s)	55, 137
FaiI	YATR	5 cut(s)	53, 125, 135, 221, 223
FaqI	GGGAC	1 cut(s)	134
FatI	CATG	2 cut(s)	51, 133
FblI	GTMKAC	1 cut(s)	38
HaeIII	GGCC	1 cut(s)	63
HapII	CCGG	1 cut(s)	107
Hin1I	GRCGYC	1 cut(s)	41
Hin1II	CATG	2 cut(s)	55, 137
HincII	GTYRAC	1 cut(s)	39
HindII	GTYRAC	1 cut(s)	39
HinfI	GANTC	1 cut(s)	183
HpaII	CCGG	1 cut(s)	107
HphI	GGTGA	1 cut(s)	205
Hpy166II	GTNNAC	2 cut(s)	6, 39
Hpy188III	TCNNGA	3 cut(s)	52, 173, 214
Hpy8I	GTNNAC	2 cut(s)	6, 39
Hpy99I	CGWCG	9 cut(s)	25, 28, 31, 34, 37, 40, 43, 46, 62
HpyAV	CCTTC	2 cut(s)	92, 148
HpyCH4IV	ACGT	2 cut(s)	41, 72
HpyCH4V	TGCA	1 cut(s)	151
HpySE526I	ACGT	2 cut(s)	41, 72
Hsp92I	GRCGYC	1 cut(s)	41
Hsp92II	CATG	2 cut(s)	55, 137
Kzo9I	GATC	1 cut(s)	142
LpnPI	CCDG	6 cut(s)	78, 103, 120, 130, 149, 176
MaeII	ACGT	2 cut(s)	41, 72
MaeIII	GTNAC	1 cut(s)	193
MalI	GATC	1 cut(s)	144
MboI	GATC	1 cut(s)	142
MboII	GAAGA	1 cut(s)	89
MnlI	CCTC	3 cut(s)	4, 181, 184
MroXI	GAANNNNTTC	1 cut(s)	182
MspI	CCGG	1 cut(s)	107
MspR9I	CCNGG	2 cut(s)	118, 164
MvaI	CCWGG	2 cut(s)	118, 164
NdeII	GATC	1 cut(s)	142
NlaIII	CATG	2 cut(s)	55, 137
NmuCI	GTSAC	1 cut(s)	193
PagI	TCATGA	1 cut(s)	51
PasI	CCCWGGG	1 cut(s)	117
PcsI	WCGNNNNNNNCGW	5 cut(s)	29, 32, 35, 38, 178
PdmI	GAANNNNTTC	1 cut(s)	182
PfeI	GAWTC	1 cut(s)	183
Psp6I	CCWGG	2 cut(s)	116, 162
PspGI	CCWGG	2 cut(s)	116, 162
PspPI	GGNCC	1 cut(s)	62
SalI	GTCGAC	1 cut(s)	37
Sau3AI	GATC	1 cut(s)	142
Sau96I	GGNCC	1 cut(s)	62
ScrFI	CCNGG	2 cut(s)	118, 164
SetI	ASST	3 cut(s)	44, 75, 195
SgrDI	CGTCGACG	1 cut(s)	37
StyD4I	CCNGG	2 cut(s)	116, 162
TaiI	ACGT	2 cut(s)	44, 75
TaqI	TCGA	3 cut(s)	38, 172, 186
TaqII	GACCGA	1 cut(s)	71
TfiI	GAWTC	1 cut(s)	183
TseFI	GTSAC	1 cut(s)	193
Tsp45I	GTSAC	1 cut(s)	193
TspDTI	ATGAA	2 cut(s)	40, 111
XmiI	GTMKAC	1 cut(s)	38
XmnI	GAANNNNTTC	1 cut(s)	182
ZraI	GACGTC	1 cut(s)	42

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.