Rmu_sc0028297.1_g000001
TCP Family

Belongs to the chaperonin (HSP60) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028297.1
N/A
Physical Location & Seq
Reverse (-)
1 .. 629
629 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028297.1_g000001.1.cds

Sequence Viewer

Length: 195 bp
ctgttaaggcaagctggagcaaaaacaaatgacctggccggagatggttccactacagctgtaattcttgctcatggtttgattactgaaggtgtgaaggttactgcagctggcatgaatcccattcaaattgctcgtgggatcgagaagactgcagtagccctagtttctgaactcaaattgatgtccagagag

Protein Analysis

65

Amino Acids

6.67

Weight (kDa)

8.44

Isoelectric Point (pI)

25.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AcoI YGGCCR 1 cut(s) 36
AcuI CTGAAG 1 cut(s) 108
AgsI TTSAA 1 cut(s) 128
AjnI CCWGG 1 cut(s) 33
AluBI AGCT 3 cut(s) 14, 59, 110
AluI AGCT 3 cut(s) 14, 59, 110
AlwI GGATC 1 cut(s) 149
AoxI GGCC 1 cut(s) 36
ApeKI GCWGC 1 cut(s) 107
BauI CACGAG 1 cut(s) 135
BbsI GAAGAC 1 cut(s) 155
BbvI GCAGC 1 cut(s) 119
BccI CCATC 1 cut(s) 38
BcgI CGANNNNNNTGC 2 cut(s) 134, 168
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 164
BfmI CTRYAG 3 cut(s) 54, 105, 153
BisI GCNGC 1 cut(s) 108
BlsI GCNGC 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 35
BmiI GGNNCC 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 35
BpiI GAAGAC 1 cut(s) 155
BpmI CTGGAG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 35
BseXI GCAGC 1 cut(s) 119
BshFI GGCC 1 cut(s) 38
BsiSI CCGG 1 cut(s) 39
BsnI GGCC 1 cut(s) 38
Bsp143I GATC 1 cut(s) 141
BspANI GGCC 1 cut(s) 38
BspLI GGNNCC 1 cut(s) 49
BspMAI CTGCAG 2 cut(s) 109, 157
BspPI GGATC 1 cut(s) 149
BssMI GATC 1 cut(s) 141
BssSI CACGAG 1 cut(s) 135
Bst2BI CACGAG 1 cut(s) 135
Bst2UI CCWGG 1 cut(s) 35
BstC8I GCNNGC 2 cut(s) 12, 112
BstKTI GATC 1 cut(s) 144
BstMBI GATC 1 cut(s) 141
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
BstSFI CTRYAG 3 cut(s) 54, 105, 153
BstV1I GCAGC 1 cut(s) 119
BstV2I GAAGAC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 38
Cac8I GCNNGC 2 cut(s) 12, 112
CviAII CATG 2 cut(s) 74, 115
CviJI RGCY 5 cut(s) 14, 38, 59, 110, 161
CviKI_1 RGCY 5 cut(s) 14, 38, 59, 110, 161
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
EaeI YGGCCR 1 cut(s) 36
Eco57I CTGAAG 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 33
FaeI CATG 2 cut(s) 77, 118
FaiI YATR 2 cut(s) 75, 116
FatI CATG 2 cut(s) 73, 114
Fnu4HI GCNGC 1 cut(s) 108
Fsp4HI GCNGC 1 cut(s) 108
FspBI CTAG 1 cut(s) 164
GluI GCNGC 1 cut(s) 108
GsuI CTGGAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 38
HapII CCGG 1 cut(s) 39
Hin1II CATG 2 cut(s) 77, 118
HinfI GANTC 1 cut(s) 118
HpaII CCGG 1 cut(s) 39
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 145, 189
HpyAV CCTTC 2 cut(s) 83, 91
HpyCH4V TGCA 2 cut(s) 107, 155
Hsp92II CATG 2 cut(s) 77, 118
Kzo9I GATC 1 cut(s) 141
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 4 cut(s) 20, 47, 52, 96
Lsp1109I GCAGC 1 cut(s) 119
MaeI CTAG 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 100
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MboII GAAGA 1 cut(s) 160
MluCI AATT 3 cut(s) 63, 129, 179
MseI TTAA 1 cut(s) 5
MspA1I CMGCKG 2 cut(s) 59, 110
MspI CCGG 1 cut(s) 39
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NdeII GATC 1 cut(s) 141
NlaIII CATG 2 cut(s) 77, 118
NlaIV GGNNCC 1 cut(s) 49
PfeI GAWTC 1 cut(s) 118
PkrI GCNGC 1 cut(s) 109
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 49
PstI CTGCAG 2 cut(s) 109, 157
PvuII CAGCTG 2 cut(s) 59, 110
SaqAI TTAA 1 cut(s) 5
SatI GCNGC 1 cut(s) 108
Sau3AI GATC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 35
SetI ASST 6 cut(s) 16, 36, 61, 94, 102, 112
SfcI CTRYAG 3 cut(s) 54, 105, 153
Sse9I AATT 3 cut(s) 63, 129, 179
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 33
TaqI TCGA 1 cut(s) 144
TasI AATT 3 cut(s) 63, 129, 179
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TseI GCWGC 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 131
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.