Rmu_sc0030641.1_g000001
TCP Family

Belongs to the chaperonin (HSP60) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030641.1
N/A
Physical Location & Seq
Forward (+)
1 .. 290
290 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030641.1_g000001.1.cds

Sequence Viewer

Length: 209 bp
gagctcttatttaccctctgaaattgatagccaagaatgctggtgtgaatggaagtgtggtcagcgagaaggtgctctctagcgacaactttaagtatggatataatgctgcaactggaaactatgaagatttaatggctgctggaatcattgatcctaccaaggtgagttgctgtattgagcttttctctgggaggtggggaccataa

Protein Analysis

68

Amino Acids

7.24

Weight (kDa)

6.32

Isoelectric Point (pI)

21.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 148
AluBI AGCT 2 cut(s) 4, 183
AluI AGCT 2 cut(s) 4, 183
Alw21I GWGCWC 2 cut(s) 6, 77
AlwI GGATC 1 cut(s) 148
ApeKI GCWGC 2 cut(s) 109, 139
AspS9I GGNCC 1 cut(s) 202
AsuHPI GGTGA 1 cut(s) 177
AvaII GGWCC 1 cut(s) 202
BanII GRGCYC 1 cut(s) 6
Bbv12I GWGCWC 2 cut(s) 6, 77
BbvI GCAGC 2 cut(s) 96, 126
BfaI CTAG 1 cut(s) 80
BisI GCNGC 2 cut(s) 110, 140
BlsI GCNGC 2 cut(s) 111, 141
Bme18I GGWCC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 202
BmiI GGNNCC 1 cut(s) 203
BplI GAGNNNNNCTC 2 cut(s) 172, 204
BsaJI CCNNGG 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 161
BseNI ACTGG 1 cut(s) 120
BseXI GCAGC 2 cut(s) 96, 126
BsiHKAI GWGCWC 2 cut(s) 6, 77
BsmI GAATGC 1 cut(s) 42
Bsp1286I GDGCHC 2 cut(s) 6, 77
Bsp143I GATC 1 cut(s) 153
BspLI GGNNCC 1 cut(s) 203
BspPI GGATC 1 cut(s) 148
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 161
BssMI GATC 1 cut(s) 153
BssT1I CCWWGG 1 cut(s) 161
BstKTI GATC 1 cut(s) 156
BstMBI GATC 1 cut(s) 153
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstV1I GCAGC 2 cut(s) 96, 126
Cfr13I GGNCC 1 cut(s) 202
CviJI RGCY 4 cut(s) 4, 31, 139, 183
CviKI_1 RGCY 4 cut(s) 4, 31, 139, 183
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
Ecl136II GAGCTC 1 cut(s) 4
Eco130I CCWWGG 1 cut(s) 161
Eco24I GRGCYC 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 202
Eco53kI GAGCTC 1 cut(s) 4
EcoICRI GAGCTC 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 161
EcoT38I GRGCYC 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 161
FaiI YATR 4 cut(s) 98, 104, 125, 207
Fnu4HI GCNGC 2 cut(s) 110, 140
FriOI GRGCYC 1 cut(s) 6
Fsp4HI GCNGC 2 cut(s) 110, 140
FspBI CTAG 1 cut(s) 80
GluI GCNGC 2 cut(s) 110, 140
HinfI GANTC 1 cut(s) 146
HphI GGTGA 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 20
HpyAV CCTTC 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
Kzo9I GATC 1 cut(s) 153
LpnPI CCDG 4 cut(s) 26, 101, 128, 176
Lsp1109I GCAGC 2 cut(s) 96, 126
MaeI CTAG 1 cut(s) 80
MalI GATC 1 cut(s) 155
MboI GATC 1 cut(s) 153
MboII GAAGA 1 cut(s) 139
MhlI GDGCHC 2 cut(s) 6, 77
MluCI AATT 1 cut(s) 22
MnlI CCTC 2 cut(s) 26, 188
MseI TTAA 2 cut(s) 92, 133
Mva1269I GAATGC 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 1 cut(s) 153
NlaIV GGNNCC 1 cut(s) 203
PctI GAATGC 1 cut(s) 42
PfeI GAWTC 1 cut(s) 146
PkrI GCNGC 2 cut(s) 111, 141
Psp124BI GAGCTC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 203
PspPI GGNCC 1 cut(s) 202
SacI GAGCTC 1 cut(s) 6
SaqAI TTAA 2 cut(s) 92, 133
SatI GCNGC 2 cut(s) 110, 140
Sau3AI GATC 1 cut(s) 153
Sau96I GGNCC 1 cut(s) 202
SduI GDGCHC 2 cut(s) 6, 77
SetI ASST 5 cut(s) 6, 74, 167, 185, 199
SgeI CNNG 8 cut(s) 45, 53, 78, 92, 128, 155, 174, 203
SinI GGWCC 1 cut(s) 202
Sse9I AATT 1 cut(s) 22
SspMI CTAG 1 cut(s) 80
SstI GAGCTC 1 cut(s) 6
StyI CCWWGG 1 cut(s) 161
TasI AATT 1 cut(s) 22
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 2 cut(s) 92, 133
Tru9I TTAA 2 cut(s) 92, 133
TseI GCWGC 2 cut(s) 109, 139
TspDTI ATGAA 1 cut(s) 140
VpaK11BI GGWCC 1 cut(s) 202
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.