Rmu_sc0033283.1_g000001

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033283.1
N/A
Physical Location & Seq
Reverse (-)
48 .. 844
797 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033283.1_g000001.1.cds

Sequence Viewer

Length: 438 bp
atgctttggataaaagacttgcaattgtcaaagattgttacttggacctgggatcttttcctgaagacaaagaaatccgagttcatgacctcattgatatgtgggcagagttatatgaatatagatgatgacagtgtgtgctttgcaaatgtctatgaacttgccaataggaatctggctaatctggttgacagaaggaacagtcgtgtgaagatggagggtgacgattactacggtctacggtatgttacccaacatgatttgcttcgagagctagctatttacaacgctaagctagacccggtagagcaaagacaaagaatgaacatagaaataaggggaaacaaaatccccaagtggtggagggaacaaaaaagtcaccctatcaaggctcgcttgttatctattattacaactactggcgcactcatcaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

145

Amino Acids

17.17

Weight (kDa)

9.39

Isoelectric Point (pI)

36.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 360
AccI GTMKAC 1 cut(s) 238
AclWI GGATC 1 cut(s) 60
AcuI CTGAAG 1 cut(s) 83
AfiI CCNNNNNNNGG 2 cut(s) 360, 388
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 3 cut(s) 274, 278, 295
AluI AGCT 3 cut(s) 274, 278, 295
AlwI GGATC 1 cut(s) 60
AspLEI GCGC 1 cut(s) 425
AspS9I GGNCC 1 cut(s) 45
AsuC2I CCSGG 1 cut(s) 302
AsuHPI GGTGA 2 cut(s) 233, 371
AsuNHI GCTAGC 1 cut(s) 274
AvaII GGWCC 1 cut(s) 45
BbsI GAAGAC 1 cut(s) 71
BccI CCATC 1 cut(s) 208
BciT130I CCWGG 1 cut(s) 49
BcnI CCSGG 1 cut(s) 302
BfaI CTAG 2 cut(s) 275, 296
BlpI GCTNAGC 1 cut(s) 291
Bme1390I CCNGG 2 cut(s) 49, 302
Bme18I GGWCC 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 45
BmrFI CCNGG 2 cut(s) 49, 302
BmtI GCTAGC 1 cut(s) 278
BpiI GAAGAC 1 cut(s) 71
Bpu1102I GCTNAGC 1 cut(s) 291
BpuMI CCSGG 1 cut(s) 302
BsaJI CCNNGG 1 cut(s) 48
Bsc4I CCNNNNNNNGG 2 cut(s) 360, 388
Bse1I ACTGG 1 cut(s) 424
BseBI CCWGG 1 cut(s) 49
BseDI CCNNGG 1 cut(s) 48
BseLI CCNNNNNNNGG 2 cut(s) 360, 388
BseNI ACTGG 1 cut(s) 424
BsiSI CCGG 1 cut(s) 302
BslI CCNNNNNNNGG 2 cut(s) 360, 388
Bsp143I GATC 1 cut(s) 52
Bsp1720I GCTNAGC 1 cut(s) 291
BspHI TCATGA 1 cut(s) 84
BspOI GCTAGC 1 cut(s) 278
BspPI GGATC 1 cut(s) 60
BsrI ACTGG 1 cut(s) 424
BssECI CCNNGG 1 cut(s) 48
BssMI GATC 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 49
Bst4CI ACNGT 4 cut(s) 134, 203, 236, 243
BstC8I GCNNGC 2 cut(s) 276, 394
BstDEI CTNAG 1 cut(s) 291
BstHHI GCGC 1 cut(s) 425
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 271
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 2 cut(s) 47, 300
BstV2I GAAGAC 1 cut(s) 71
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
BtsIMutI CAGTG 1 cut(s) 139
Cac8I GCNNGC 2 cut(s) 276, 394
CciI TCATGA 1 cut(s) 84
CfoI GCGC 1 cut(s) 425
Cfr13I GGNCC 1 cut(s) 45
CviAII CATG 2 cut(s) 85, 257
CviJI RGCY 5 cut(s) 179, 274, 278, 295, 392
CviKI_1 RGCY 5 cut(s) 179, 274, 278, 295, 392
DdeI CTNAG 1 cut(s) 291
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 45
Eco57I CTGAAG 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 47
FaeI CATG 2 cut(s) 88, 260
FaiI YATR 9 cut(s) 86, 100, 114, 116, 122, 156, 246, 258, 329
FalI AAGNNNNNCTT 2 cut(s) 380, 412
FatI CATG 2 cut(s) 84, 256
FblI GTMKAC 1 cut(s) 238
FspBI CTAG 2 cut(s) 275, 296
GlaI GCGC 1 cut(s) 424
HapII CCGG 1 cut(s) 302
HhaI GCGC 1 cut(s) 425
Hin1II CATG 2 cut(s) 88, 260
Hin6I GCGC 1 cut(s) 423
HinP1I GCGC 1 cut(s) 423
HincII GTYRAC 1 cut(s) 190
HindII GTYRAC 1 cut(s) 190
HinfI GANTC 1 cut(s) 172
HpaII CCGG 1 cut(s) 302
HphI GGTGA 2 cut(s) 233, 371
Hpy166II GTNNAC 2 cut(s) 190, 239
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 3 cut(s) 61, 85, 269
Hpy8I GTNNAC 2 cut(s) 190, 239
HpyAV CCTTC 1 cut(s) 189
HpyCH4III ACNGT 4 cut(s) 134, 203, 236, 243
HpyCH4V TGCA 2 cut(s) 22, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 271
HpyF3I CTNAG 1 cut(s) 291
Hsp92II CATG 2 cut(s) 88, 260
HspAI GCGC 1 cut(s) 423
Kzo9I GATC 1 cut(s) 52
LpnPI CCDG 7 cut(s) 34, 61, 74, 161, 170, 315, 405
MaeI CTAG 2 cut(s) 275, 296
MaeIII GTNAC 4 cut(s) 37, 221, 247, 377
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 2 cut(s) 76, 223
MfeI CAATTG 1 cut(s) 23
MflI RGATCY 1 cut(s) 52
MluCI AATT 1 cut(s) 23
MnlI CCTC 3 cut(s) 100, 211, 357
MslI CAYNNNNRTG 1 cut(s) 97
MspI CCGG 1 cut(s) 302
MspR9I CCNGG 2 cut(s) 49, 302
MunI CAATTG 1 cut(s) 23
MvaI CCWGG 1 cut(s) 49
MwoI GCNNNNNNNGC 1 cut(s) 271
NciI CCSGG 1 cut(s) 302
NdeII GATC 1 cut(s) 52
NheI GCTAGC 1 cut(s) 274
NlaIII CATG 2 cut(s) 88, 260
NmuCI GTSAC 2 cut(s) 221, 377
PagI TCATGA 1 cut(s) 84
PfeI GAWTC 1 cut(s) 172
PflMI CCANNNNNTGG 1 cut(s) 360
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 45
PsuI RGATCY 1 cut(s) 52
RseI CAYNNNNRTG 1 cut(s) 97
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 45
ScrFI CCNGG 2 cut(s) 49, 302
SetI ASST 5 cut(s) 50, 92, 276, 280, 297
SinI GGWCC 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 97
Sse9I AATT 1 cut(s) 23
SspMI CTAG 2 cut(s) 275, 296
StyD4I CCNGG 2 cut(s) 47, 300
TaaI ACNGT 4 cut(s) 134, 203, 236, 243
TaqI TCGA 1 cut(s) 268
TasI AATT 1 cut(s) 23
TfiI GAWTC 1 cut(s) 172
TscAI CASTG 1 cut(s) 139
TseFI GTSAC 2 cut(s) 221, 377
Tsp45I GTSAC 2 cut(s) 221, 377
TspDTI ATGAA 4 cut(s) 73, 131, 171, 338
TspRI CASTG 1 cut(s) 139
Van91I CCANNNNNTGG 1 cut(s) 360
VpaK11BI GGWCC 1 cut(s) 45
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
XmiI GTMKAC 1 cut(s) 238
XspI CTAG 2 cut(s) 275, 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.