Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0034271.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 633

Gene Structure 633 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0034271.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 262 bp

aaatgctttcaacaatgaattgacgttgctagagaaggttcggcatccaaacgtcgttcagtttgttggtgctgttacccagaatatacctatgatgattgttgtagaatatcatgccaaaggtgacttaggaagctatcttcaaaagaaaggacgattatctccatcaaaagcactgagatttgctcttgacattgcaaggcatgtgcaatttattttccagccactacttctgaagtgccttatggtcccaattgaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002376 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004712 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006952 GO:0006955 GO:0006970 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009628 GO:0009898 GO:0009987 GO:0012505 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0035556 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044425 GO:0044444 GO:0044459 GO:0044464 GO:0045087 GO:0046777 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071704 GO:0071944 GO:0098552 GO:0098562 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 Pkinase_Tyr

Protein Analysis

86

Amino Acids

9.76

Weight (kDa)

9.58

Isoelectric Point (pI)

33.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	255
AgsI	TTSAA	3 cut(s)	11, 144, 258
AluBI	AGCT	1 cut(s)	136
AluI	AGCT	1 cut(s)	136
AspS9I	GGNCC	1 cut(s)	248
AsuHPI	GGTGA	1 cut(s)	135
AvaII	GGWCC	1 cut(s)	248
BccI	CCATC	1 cut(s)	173
BfaI	CTAG	1 cut(s)	30
Bme18I	GGWCC	1 cut(s)	248
BmgT120I	GGNCC	1 cut(s)	248
BmiI	GGNNCC	1 cut(s)	250
BmsI	GCATC	1 cut(s)	53
BplI	GAGNNNNNCTC	2 cut(s)	170, 202
Bse3DI	GCAATG	1 cut(s)	193
BseGI	GGATG	1 cut(s)	44
BseMI	GCAATG	1 cut(s)	193
BseMII	CTCAG	1 cut(s)	168
BslFI	GGGAC	1 cut(s)	234
BsmFI	GGGAC	1 cut(s)	234
BspCNI	CTCAG	1 cut(s)	169
BspLI	GGNNCC	1 cut(s)	250
BsrDI	GCAATG	1 cut(s)	193
BstDEI	CTNAG	2 cut(s)	128, 177
BstF5I	GGATG	1 cut(s)	44
BstNSI	RCATGY	1 cut(s)	207
BtsCI	GGATG	1 cut(s)	44
BtsIMutI	CAGTG	1 cut(s)	174
Cfr13I	GGNCC	1 cut(s)	248
CviAII	CATG	2 cut(s)	114, 204
CviJI	RGCY	2 cut(s)	136, 224
CviKI_1	RGCY	2 cut(s)	136, 224
DdeI	CTNAG	2 cut(s)	128, 177
Eco47I	GGWCC	1 cut(s)	248
Eco57I	CTGAAG	1 cut(s)	255
FaeI	CATG	2 cut(s)	117, 207
FaiI	YATR	5 cut(s)	87, 93, 115, 205, 246
FaqI	GGGAC	1 cut(s)	234
FatI	CATG	2 cut(s)	113, 203
FokI	GGATG	1 cut(s)	31
FspBI	CTAG	1 cut(s)	30
Hin1II	CATG	2 cut(s)	117, 207
HphI	GGTGA	1 cut(s)	135
Hpy188I	TCNGA	1 cut(s)	235
Hpy188III	TCNNGA	1 cut(s)	189
Hpy99I	CGWCG	1 cut(s)	57
HpyAV	CCTTC	1 cut(s)	29
HpyCH4IV	ACGT	2 cut(s)	24, 52
HpyCH4V	TGCA	2 cut(s)	198, 209
HpyF3I	CTNAG	2 cut(s)	128, 177
HpySE526I	ACGT	2 cut(s)	24, 52
Hsp92II	CATG	2 cut(s)	117, 207
LpnPI	CCDG	2 cut(s)	93, 234
LweI	GCATC	1 cut(s)	53
MaeI	CTAG	1 cut(s)	30
MaeII	ACGT	2 cut(s)	24, 52
MaeIII	GTNAC	2 cut(s)	74, 123
MboII	GAAGA	1 cut(s)	132
MfeI	CAATTG	1 cut(s)	253
MluCI	AATT	3 cut(s)	18, 210, 253
MunI	CAATTG	1 cut(s)	253
NlaIII	CATG	2 cut(s)	117, 207
NlaIV	GGNNCC	1 cut(s)	250
NmuCI	GTSAC	1 cut(s)	123
NspI	RCATGY	1 cut(s)	207
PspN4I	GGNNCC	1 cut(s)	250
PspPI	GGNCC	1 cut(s)	248
Sau96I	GGNCC	1 cut(s)	248
SetI	ASST	6 cut(s)	27, 40, 55, 92, 125, 138
SfaNI	GCATC	1 cut(s)	53
SgeI	CNNG	7 cut(s)	42, 92, 126, 201, 211, 216, 233
SinI	GGWCC	1 cut(s)	248
Sse9I	AATT	3 cut(s)	18, 210, 253
SspMI	CTAG	1 cut(s)	30
TaiI	ACGT	2 cut(s)	27, 55
TasI	AATT	3 cut(s)	18, 210, 253
TscAI	CASTG	1 cut(s)	181
TseFI	GTSAC	1 cut(s)	123
Tsp45I	GTSAC	1 cut(s)	123
TspDTI	ATGAA	1 cut(s)	31
TspRI	CASTG	1 cut(s)	181
VpaK11BI	GGWCC	1 cut(s)	248
XceI	RCATGY	1 cut(s)	207
XspI	CTAG	1 cut(s)	30

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.