Rmu_sc0036419.1_g000002

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036419.1
N/A
Physical Location & Seq
Forward (+)
2137 .. 2482
346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036419.1_g000002.1.cds

Sequence Viewer

Length: 261 bp
atggggagcgttgaagaagagcaagtatgggatgtggaagagaccgtctttgttgcggtgggggacgacgtgaagcagagcgaaacgacgctgttttgggccgtcaagaacttcgtcggcaagaatatatgcctccttcacgtccaccgcccttcattgtgtgatgaaaatagttcagtaaatttacgaaatcttctaaacgaatacctactgattctgatcggagcaggagtgagtattcaatccccgattttaagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.56

Weight (kDa)

4.48

Isoelectric Point (pI)

59.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 56, 148
AcsI RAATTY 1 cut(s) 181
AgsI TTSAA 2 cut(s) 14, 242
AjiI CACGTC 2 cut(s) 70, 142
Alw26I GTCTC 1 cut(s) 35
AoxI GGCC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 181
AspS9I GGNCC 1 cut(s) 99
BceAI ACGGC 1 cut(s) 86
BcoDI GTCTC 1 cut(s) 35
BmgBI CACGTC 2 cut(s) 70, 142
BmgT120I GGNCC 1 cut(s) 99
BsaBI GATNNNNATC 1 cut(s) 218
BsaI GGTCTC 1 cut(s) 35
BsaXI ACNNNNNCTCC 2 cut(s) 216, 246
Bse8I GATNNNNATC 1 cut(s) 218
BseGI GGATG 1 cut(s) 37
BseJI GATNNNNATC 1 cut(s) 218
BshFI GGCC 1 cut(s) 101
BslFI GGGAC 1 cut(s) 77
BsmAI GTCTC 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 77
BsnI GGCC 1 cut(s) 101
Bso31I GGTCTC 1 cut(s) 35
Bsp143I GATC 1 cut(s) 219
BspACI CCGC 2 cut(s) 56, 148
BspANI GGCC 1 cut(s) 101
BspQI GCTCTTC 1 cut(s) 12
BspTNI GGTCTC 1 cut(s) 35
BssMI GATC 1 cut(s) 219
Bst4CI ACNGT 1 cut(s) 46
Bst6I CTCTTC 2 cut(s) 12, 33
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 1 cut(s) 222
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 1 cut(s) 219
BsuRI GGCC 1 cut(s) 101
BtrI CACGTC 2 cut(s) 70, 142
BtsCI GGATG 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 99
CseI GACGC 1 cut(s) 97
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
DpnI GATC 1 cut(s) 221
DpnII GATC 1 cut(s) 219
Eam1104I CTCTTC 2 cut(s) 12, 33
EarI CTCTTC 2 cut(s) 12, 33
Eco31I GGTCTC 1 cut(s) 35
FaiI YATR 3 cut(s) 28, 128, 130
FaqI GGGAC 1 cut(s) 77
FokI GGATG 1 cut(s) 44
HaeIII GGCC 1 cut(s) 101
HgaI GACGC 1 cut(s) 97
HinfI GANTC 1 cut(s) 214
Hpy166II GTNNAC 1 cut(s) 145
Hpy188I TCNGA 2 cut(s) 219, 224
Hpy188III TCNNGA 1 cut(s) 106
Hpy8I GTNNAC 1 cut(s) 145
Hpy99I CGWCG 3 cut(s) 71, 91, 119
HpyAV CCTTC 2 cut(s) 146, 162
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4IV ACGT 2 cut(s) 69, 141
HpySE526I ACGT 2 cut(s) 69, 141
Kzo9I GATC 1 cut(s) 219
LguI GCTCTTC 1 cut(s) 12
LmnI GCTCC 2 cut(s) 6, 224
LpnPI CCDG 1 cut(s) 213
MaeII ACGT 2 cut(s) 69, 141
MalI GATC 1 cut(s) 221
MboI GATC 1 cut(s) 219
MboII GAAGA 4 cut(s) 26, 29, 50, 185
MluCI AATT 1 cut(s) 181
MnlI CCTC 1 cut(s) 143
MseI TTAA 1 cut(s) 254
NdeII GATC 1 cut(s) 219
PciSI GCTCTTC 1 cut(s) 12
PfeI GAWTC 1 cut(s) 214
PspPI GGNCC 1 cut(s) 99
SapI GCTCTTC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 254
Sau3AI GATC 1 cut(s) 219
Sau96I GGNCC 1 cut(s) 99
SetI ASST 3 cut(s) 72, 144, 210
SgeI CNNG 6 cut(s) 35, 82, 118, 133, 152, 240
Sse9I AATT 1 cut(s) 181
SsiI CCGC 2 cut(s) 56, 148
TaaI ACNGT 1 cut(s) 46
TaiI ACGT 2 cut(s) 72, 144
TasI AATT 1 cut(s) 181
TfiI GAWTC 1 cut(s) 214
Tru1I TTAA 1 cut(s) 254
Tru9I TTAA 1 cut(s) 254
TspDTI ATGAA 2 cut(s) 144, 180
XapI RAATTY 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.