Rmu_sc0039617.1_g000001

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039617.1
N/A
Physical Location & Seq
Forward (+)
5 .. 697
693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039617.1_g000001.1.cds

Sequence Viewer

Length: 250 bp
atgaattatttgcaccaaaataatatagtccacagagaccttaagactgccaatcttctgatggatgaacacgaagttgttaaggttgctgattttggggttgccagagtccaagcacaatctggagtgatgacagctgaaaccggaacataccgatggatggctcctgaggtcattgaacacaaaccgtatgatcacaaggcagatgttttcagttttggtatagtgttgtgggagcttctaacaggag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.48

Weight (kDa)

5.61

Isoelectric Point (pI)

36.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 160
AflII CTTAAG 1 cut(s) 41
AgsI TTSAA 1 cut(s) 179
AluBI AGCT 2 cut(s) 137, 238
AluI AGCT 2 cut(s) 137, 238
Alw26I GTCTC 1 cut(s) 30
AxyI CCTNAGG 1 cut(s) 168
BccI CCATC 3 cut(s) 55, 150, 154
BclI TGATCA 1 cut(s) 193
BcoDI GTCTC 1 cut(s) 30
BfrI CTTAAG 1 cut(s) 41
BmiI GGNNCC 1 cut(s) 165
BpmI CTGGAG 1 cut(s) 144
BsaI GGTCTC 1 cut(s) 30
BsaWI WCCGGW 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse21I CCTNAGG 1 cut(s) 168
BseGI GGATG 2 cut(s) 70, 165
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 159
BsiSI CCGG 1 cut(s) 144
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 30
Bso31I GGTCTC 1 cut(s) 30
Bsp143I GATC 1 cut(s) 193
BspCNI CTCAG 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 165
BspTI CTTAAG 1 cut(s) 41
BspTNI GGTCTC 1 cut(s) 30
BssMI GATC 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 189
BstAFI CTTAAG 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 168
BstF5I GGATG 2 cut(s) 70, 165
BstKTI GATC 1 cut(s) 196
BstMAI GTCTC 1 cut(s) 30
BstMBI GATC 1 cut(s) 193
Bsu36I CCTNAGG 1 cut(s) 168
BtsCI GGATG 2 cut(s) 70, 165
CviJI RGCY 3 cut(s) 137, 164, 238
CviKI_1 RGCY 3 cut(s) 137, 164, 238
DdeI CTNAG 1 cut(s) 168
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
Eco31I GGTCTC 1 cut(s) 30
Eco81I CCTNAGG 1 cut(s) 168
FaiI YATR 4 cut(s) 26, 151, 192, 224
FbaI TGATCA 1 cut(s) 193
FokI GGATG 2 cut(s) 77, 172
GsuI CTGGAG 1 cut(s) 144
HapII CCGG 1 cut(s) 144
HinfI GANTC 1 cut(s) 108
HpaII CCGG 1 cut(s) 144
Hpy166II GTNNAC 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 2 cut(s) 123, 167
Hpy8I GTNNAC 1 cut(s) 31
HpyCH4III ACNGT 1 cut(s) 189
HpyCH4V TGCA 1 cut(s) 13
HpyF3I CTNAG 1 cut(s) 168
Ksp22I TGATCA 1 cut(s) 193
Kzo9I GATC 1 cut(s) 193
LmnI GCTCC 2 cut(s) 169, 235
LpnPI CCDG 5 cut(s) 108, 118, 157, 180, 231
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MboII GAAGA 1 cut(s) 47
MluCI AATT 1 cut(s) 4
MlyI GAGTC 1 cut(s) 117
MnlI CCTC 1 cut(s) 163
MseI TTAA 2 cut(s) 42, 81
MslI CAYNNNNRTG 1 cut(s) 154
MspA1I CMGCKG 1 cut(s) 137
MspCI CTTAAG 1 cut(s) 41
MspI CCGG 1 cut(s) 144
NdeII GATC 1 cut(s) 193
NlaIV GGNNCC 1 cut(s) 165
PleI GAGTC 1 cut(s) 116
PpsI GAGTC 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 165
PvuII CAGCTG 1 cut(s) 137
RseI CAYNNNNRTG 1 cut(s) 154
SaqAI TTAA 2 cut(s) 42, 81
Sau3AI GATC 1 cut(s) 193
SchI GAGTC 1 cut(s) 117
SetI ASST 5 cut(s) 42, 87, 139, 174, 240
SgeI CNNG 7 cut(s) 83, 117, 125, 135, 156, 179, 211
SmiMI CAYNNNNRTG 1 cut(s) 154
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 1 cut(s) 4
TaaI ACNGT 1 cut(s) 189
TasI AATT 1 cut(s) 4
Tru1I TTAA 2 cut(s) 42, 81
Tru9I TTAA 2 cut(s) 42, 81
TspDTI ATGAA 2 cut(s) 17, 81
Vha464I CTTAAG 1 cut(s) 41
XcmI CCANNNNNNNNNTGG 2 cut(s) 58, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.