Rmu_sc0040573.1_g000001

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040573.1
N/A
Physical Location & Seq
Reverse (-)
1 .. 360
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040573.1_g000001.1.cds

Sequence Viewer

Length: 231 bp
atggatcgaagtgaaattcttgaagcagaggacaatctcacattgcagacacattcccctctgtcgattgttgccattgctatcaatggcaacagaaaaagcaaatacattgtgaagtgggcgctggagaagtttattcctgaaggaaccctctttttcaagttgatacatgtccgagcaagaataactggaattccaacaccaatggggaatctgattcctatttcagaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.66

Weight (kDa)

8.14

Isoelectric Point (pI)

23.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 2 cut(s) 15, 192
AcuI CTGAAG 1 cut(s) 162
AflIII ACRYGT 1 cut(s) 169
AgsI TTSAA 2 cut(s) 23, 160
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 2 cut(s) 15, 192
AspLEI GCGC 1 cut(s) 124
BfoI RGCGCY 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 148
BpmI CTGGAG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 193
Bse3DI GCAATG 2 cut(s) 41, 75
BseMI GCAATG 2 cut(s) 41, 75
BseNI ACTGG 1 cut(s) 193
Bsp143I GATC 1 cut(s) 4
BspLI GGNNCC 1 cut(s) 148
BspPI GGATC 1 cut(s) 12
BsrDI GCAATG 2 cut(s) 41, 75
BsrI ACTGG 1 cut(s) 193
BssMI GATC 1 cut(s) 4
BstH2I RGCGCY 1 cut(s) 125
BstHHI GCGC 1 cut(s) 124
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstNSI RCATGY 1 cut(s) 173
CfoI GCGC 1 cut(s) 124
CviAII CATG 1 cut(s) 170
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 162
EcoRI GAATTC 1 cut(s) 192
FaeI CATG 1 cut(s) 173
FaiI YATR 1 cut(s) 171
FatI CATG 1 cut(s) 169
GlaI GCGC 1 cut(s) 123
GsuI CTGGAG 1 cut(s) 146
HaeII RGCGCY 1 cut(s) 125
HhaI GCGC 1 cut(s) 124
Hin1II CATG 1 cut(s) 173
Hin6I GCGC 1 cut(s) 122
HinP1I GCGC 1 cut(s) 122
HinfI GANTC 2 cut(s) 211, 217
Hpy188I TCNGA 3 cut(s) 176, 216, 229
Hpy188III TCNNGA 2 cut(s) 20, 140
HpyAV CCTTC 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 46
Hsp92II CATG 1 cut(s) 173
HspAI GCGC 1 cut(s) 122
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 110, 153, 174
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MluCI AATT 2 cut(s) 15, 192
MmeI TCCRAC 1 cut(s) 221
MnlI CCTC 3 cut(s) 22, 69, 161
NdeII GATC 1 cut(s) 4
NlaIII CATG 1 cut(s) 173
NlaIV GGNNCC 1 cut(s) 148
NspI RCATGY 1 cut(s) 173
PciI ACATGT 1 cut(s) 169
PfeI GAWTC 2 cut(s) 211, 217
PscI ACATGT 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 148
Sau3AI GATC 1 cut(s) 4
SgeI CNNG 8 cut(s) 32, 137, 152, 172, 182, 188, 192, 201
Sse9I AATT 2 cut(s) 15, 192
TaqI TCGA 2 cut(s) 7, 65
TasI AATT 2 cut(s) 15, 192
TfiI GAWTC 2 cut(s) 211, 217
XapI RAATTY 2 cut(s) 15, 192
XceI RCATGY 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.