Rmu_sc0041107.1_g000001

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041107.1
N/A
Physical Location & Seq
Forward (+)
1145 .. 1448
304 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041107.1_g000001.1.cds

Sequence Viewer

Length: 304 bp
atggggtgtgtaattagcagagaaacgtcctcgggagtagagtctgagtctaagggtgtgaagaaggatttgagtgtggaatccaataggaaggtagatgatgttgcggtggccaaggtagatagtgaggctgaagtcgggggtgaggttgctgttggtgggggtgaggctcagaaggtggagaatggtcatgaaagtcagcggcctccaaagggggagagaaggcggtccaagccaaacccgaggagtagtctgccacataaagcccgtggtgagcaggtagctgctgggtggcctccttggc

Protein Analysis

101

Amino Acids

10.75

Weight (kDa)

7.89

Isoelectric Point (pI)

49.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 268
AciI CCGC 3 cut(s) 107, 202, 226
AcoI YGGCCR 1 cut(s) 111
AcuI CTGAAG 1 cut(s) 153
AfiI CCNNNNNNNGG 1 cut(s) 212
AluBI AGCT 1 cut(s) 284
AluI AGCT 1 cut(s) 284
Ama87I CYCGRG 2 cut(s) 31, 241
AoxI GGCC 3 cut(s) 111, 203, 293
ApeKI GCWGC 1 cut(s) 284
AspS9I GGNCC 1 cut(s) 228
AsuHPI GGTGA 3 cut(s) 155, 176, 284
AvaI CYCGRG 2 cut(s) 31, 241
AvaII GGWCC 1 cut(s) 228
BalI TGGCCA 1 cut(s) 113
BbvI GCAGC 1 cut(s) 271
BfuAI ACCTGC 1 cut(s) 268
BglI GCCNNNNNGGC 1 cut(s) 301
BisI GCNGC 2 cut(s) 203, 285
BlsI GCNGC 2 cut(s) 204, 286
Bme18I GGWCC 1 cut(s) 228
BmeT110I CYCGRG 2 cut(s) 31, 241
BmgT120I GGNCC 1 cut(s) 228
BsaJI CCNNGG 5 cut(s) 30, 114, 242, 268, 299
Bsc4I CCNNNNNNNGG 1 cut(s) 212
BseDI CCNNGG 5 cut(s) 30, 114, 242, 268, 299
BseLI CCNNNNNNNGG 1 cut(s) 212
BseMII CTCAG 2 cut(s) 36, 185
BseRI GAGGAG 1 cut(s) 259
BseXI GCAGC 1 cut(s) 271
BseYI CCCAGC 1 cut(s) 287
BshFI GGCC 3 cut(s) 113, 205, 295
BsiHKCI CYCGRG 2 cut(s) 31, 241
BslI CCNNNNNNNGG 1 cut(s) 212
BsnI GGCC 3 cut(s) 113, 205, 295
BsoBI CYCGRG 2 cut(s) 31, 241
BspACI CCGC 3 cut(s) 107, 202, 226
BspANI GGCC 3 cut(s) 113, 205, 295
BspCNI CTCAG 2 cut(s) 37, 184
BspHI TCATGA 1 cut(s) 190
BspMI ACCTGC 1 cut(s) 268
BssECI CCNNGG 5 cut(s) 30, 114, 242, 268, 299
BssT1I CCWWGG 2 cut(s) 114, 299
BstDEI CTNAG 3 cut(s) 45, 51, 171
BstDSI CCRYGG 1 cut(s) 268
BstMWI GCNNNNNNNGC 2 cut(s) 232, 301
BstV1I GCAGC 1 cut(s) 271
BsuRI GGCC 3 cut(s) 113, 205, 295
BtgI CCRYGG 1 cut(s) 268
BveI ACCTGC 1 cut(s) 268
CciI TCATGA 1 cut(s) 190
Cfr13I GGNCC 1 cut(s) 228
CviAII CATG 1 cut(s) 191
CviJI RGCY 8 cut(s) 113, 131, 170, 205, 235, 266, 284, 295
CviKI_1 RGCY 8 cut(s) 113, 131, 170, 205, 235, 266, 284, 295
DdeI CTNAG 3 cut(s) 45, 51, 171
EaeI YGGCCR 1 cut(s) 111
Eco130I CCWWGG 2 cut(s) 114, 299
Eco47I GGWCC 1 cut(s) 228
Eco57I CTGAAG 1 cut(s) 153
Eco88I CYCGRG 2 cut(s) 31, 241
EcoT14I CCWWGG 2 cut(s) 114, 299
ErhI CCWWGG 2 cut(s) 114, 299
FaeI CATG 1 cut(s) 194
FaiI YATR 2 cut(s) 192, 261
FatI CATG 1 cut(s) 190
Fnu4HI GCNGC 2 cut(s) 203, 285
Fsp4HI GCNGC 2 cut(s) 203, 285
GluI GCNGC 2 cut(s) 203, 285
GsaI CCCAGC 1 cut(s) 291
HaeIII GGCC 3 cut(s) 113, 205, 295
Hin1II CATG 1 cut(s) 194
HinfI GANTC 3 cut(s) 41, 47, 80
HphI GGTGA 3 cut(s) 155, 176, 284
Hpy188I TCNGA 2 cut(s) 46, 174
Hpy188III TCNNGA 2 cut(s) 33, 191
HpyAV CCTTC 4 cut(s) 58, 85, 169, 216
HpyCH4IV ACGT 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 2 cut(s) 232, 301
HpyF3I CTNAG 3 cut(s) 45, 51, 171
HpySE526I ACGT 1 cut(s) 26
Hsp92II CATG 1 cut(s) 194
LpnPI CCDG 2 cut(s) 263, 273
Lsp1109I GCAGC 1 cut(s) 271
MaeII ACGT 1 cut(s) 26
MboII GAAGA 1 cut(s) 73
MlsI TGGCCA 1 cut(s) 113
MluCI AATT 1 cut(s) 12
MluNI TGGCCA 1 cut(s) 113
MlyI GAGTC 2 cut(s) 50, 56
MnlI CCTC 6 cut(s) 40, 121, 139, 160, 216, 237
Mox20I TGGCCA 1 cut(s) 113
MscI TGGCCA 1 cut(s) 113
Msp20I TGGCCA 1 cut(s) 113
MspA1I CMGCKG 1 cut(s) 202
MwoI GCNNNNNNNGC 2 cut(s) 232, 301
NlaIII CATG 1 cut(s) 194
PagI TCATGA 1 cut(s) 190
PfeI GAWTC 1 cut(s) 80
PkrI GCNGC 2 cut(s) 204, 286
PleI GAGTC 2 cut(s) 49, 55
PpsI GAGTC 2 cut(s) 49, 55
PspFI CCCAGC 1 cut(s) 287
PspPI GGNCC 1 cut(s) 228
SatI GCNGC 2 cut(s) 203, 285
Sau96I GGNCC 1 cut(s) 228
SchI GAGTC 2 cut(s) 50, 56
SetI ASST 7 cut(s) 29, 96, 120, 150, 180, 282, 286
SinI GGWCC 1 cut(s) 228
Sse9I AATT 1 cut(s) 12
SsiI CCGC 3 cut(s) 107, 202, 226
StyI CCWWGG 2 cut(s) 114, 299
TaiI ACGT 1 cut(s) 29
TasI AATT 1 cut(s) 12
TauI GCSGC 1 cut(s) 205
TfiI GAWTC 1 cut(s) 80
TseI GCWGC 1 cut(s) 284
TspDTI ATGAA 1 cut(s) 207
VpaK11BI GGWCC 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.