Rmu_sc0042500.1_g000001

mitogen-activated protein kinase kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042500.1
N/A
Physical Location & Seq
Reverse (-)
941 .. 1793
853 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042500.1_g000001.1.cds

Sequence Viewer

Length: 219 bp
atgagtgctgttgttgacttgccaccaccttctgcaccttccgatcagttttctccagagttctgctcatttatttctgcatgtgtacagaaagatcctaaaaagagattgtcagcacatgatctcctagtgcatccttttatcagcatgtacgacgacttgaatatcgacctttcgtcttacttcactgaagcaggatctccacttgcaaccttttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000165 GO:0000187 GO:0001932 GO:0001934 GO:0002376 GO:0003002 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004708 GO:0004712 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0006950 GO:0006952 GO:0006955 GO:0006970 GO:0007154 GO:0007165 GO:0007275 GO:0007346 GO:0007389 GO:0008150 GO:0008152 GO:0009266 GO:0009409 GO:0009605 GO:0009607 GO:0009628 GO:0009631 GO:0009651 GO:0009814 GO:0009893 GO:0009914 GO:0009966 GO:0009967 GO:0009987 GO:0010051 GO:0010562 GO:0010604 GO:0010646 GO:0010647 GO:0010817 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019220 GO:0019222 GO:0019538 GO:0023014 GO:0023051 GO:0023052 GO:0023056 GO:0031098 GO:0031323 GO:0031325 GO:0031399 GO:0031401 GO:0032147 GO:0032268 GO:0032270 GO:0032501 GO:0032502 GO:0033554 GO:0033674 GO:0035556 GO:0036211 GO:0042325 GO:0042327 GO:0043085 GO:0043170 GO:0043207 GO:0043405 GO:0043406 GO:0043408 GO:0043410 GO:0043412 GO:0043549 GO:0044093 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0045087 GO:0045859 GO:0045860 GO:0045937 GO:0048518 GO:0048522 GO:0048583 GO:0048584 GO:0048856 GO:0050789 GO:0050790 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051174 GO:0051179 GO:0051234 GO:0051246 GO:0051247 GO:0051338 GO:0051347 GO:0051704 GO:0051707 GO:0051716 GO:0051726 GO:0060255 GO:0060918 GO:0065007 GO:0065008 GO:0065009 GO:0071704 GO:0071900 GO:0071902 GO:0071944 GO:0080090 GO:0098542 GO:0140096 GO:1901564 GO:1902531 GO:1902533
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.89

Weight (kDa)

4.46

Isoelectric Point (pI)

73.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 89, 205
AcuI CTGAAG 1 cut(s) 210
AfaI GTAC 2 cut(s) 87, 152
AgsI TTSAA 1 cut(s) 163
AhdI GACNNNNNGTC 1 cut(s) 175
AlwI GGATC 2 cut(s) 89, 205
BfaI CTAG 1 cut(s) 128
BmeRI GACNNNNNGTC 1 cut(s) 175
BmsI GCATC 1 cut(s) 142
BplI GAGNNNNNCTC 2 cut(s) 50, 82
BpmI CTGGAG 1 cut(s) 39
BsaXI ACNNNNNCTCC 2 cut(s) 108, 138
BseGI GGATG 1 cut(s) 133
BsgI GTGCAG 1 cut(s) 18
Bsp1407I TGTACA 1 cut(s) 85
Bsp143I GATC 4 cut(s) 43, 94, 121, 197
BspPI GGATC 2 cut(s) 89, 205
BsrGI TGTACA 1 cut(s) 85
BssMI GATC 4 cut(s) 43, 94, 121, 197
BstAUI TGTACA 1 cut(s) 85
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 4 cut(s) 46, 97, 124, 200
BstMBI GATC 4 cut(s) 43, 94, 121, 197
BstNSI RCATGY 2 cut(s) 84, 151
BstX2I RGATCY 2 cut(s) 94, 197
BstYI RGATCY 2 cut(s) 94, 197
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 186
Csp6I GTAC 2 cut(s) 86, 151
CviAII CATG 3 cut(s) 81, 119, 148
CviQI GTAC 2 cut(s) 86, 151
DpnI GATC 4 cut(s) 45, 96, 123, 199
DpnII GATC 4 cut(s) 43, 94, 121, 197
DriI GACNNNNNGTC 1 cut(s) 175
Eam1105I GACNNNNNGTC 1 cut(s) 175
Eco57I CTGAAG 1 cut(s) 210
FaeI CATG 3 cut(s) 84, 122, 151
FaiI YATR 3 cut(s) 82, 120, 149
FatI CATG 3 cut(s) 80, 118, 147
FokI GGATG 1 cut(s) 120
FspBI CTAG 1 cut(s) 128
GsuI CTGGAG 1 cut(s) 39
Hin1II CATG 3 cut(s) 84, 122, 151
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
Hpy166II GTNNAC 2 cut(s) 16, 86
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 2 cut(s) 16, 86
Hpy99I CGWCG 1 cut(s) 158
HpyAV CCTTC 2 cut(s) 39, 48
HpyCH4V TGCA 4 cut(s) 35, 80, 133, 209
Hsp92II CATG 3 cut(s) 84, 122, 151
Kzo9I GATC 4 cut(s) 43, 94, 121, 197
LpnPI CCDG 2 cut(s) 69, 180
LweI GCATC 1 cut(s) 142
MaeI CTAG 1 cut(s) 128
MalI GATC 4 cut(s) 45, 96, 123, 199
MboI GATC 4 cut(s) 43, 94, 121, 197
MflI RGATCY 2 cut(s) 94, 197
MseI TTAA 1 cut(s) 217
NdeII GATC 4 cut(s) 43, 94, 121, 197
NlaIII CATG 3 cut(s) 84, 122, 151
NspI RCATGY 2 cut(s) 84, 151
PsuI RGATCY 2 cut(s) 94, 197
RsaI GTAC 2 cut(s) 87, 152
RsaNI GTAC 2 cut(s) 86, 151
SaqAI TTAA 1 cut(s) 217
Sau3AI GATC 4 cut(s) 43, 94, 121, 197
SetI ASST 4 cut(s) 31, 40, 174, 215
SfaNI GCATC 1 cut(s) 142
SgeI CNNG 8 cut(s) 31, 68, 93, 131, 140, 160, 172, 207
SspMI CTAG 1 cut(s) 128
TaqI TCGA 1 cut(s) 168
TatI WGTACW 1 cut(s) 85
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TscAI CASTG 1 cut(s) 193
TspRI CASTG 1 cut(s) 193
XceI RCATGY 2 cut(s) 84, 151
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.