Rmu_ssc0000099.1_g000003

Nodulin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000099.1
N/A
Physical Location & Seq
Reverse (-)
7748 .. 8230
483 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 483 bp
atggaagctagactaaagaatctgacactgtccaaatgggtgtctacggtggcgagcatatggatacagtgcaccagcggcaccctatacaccttctccgtctactctcagaccctcaagaccacacagggctacgatcagtcaactctcgacactgtttctgtgttcaaggactttggagccaactgtgggattctgtctggtgttctctattcttatagtgtctcgtgggctggaccttgggttgtcctactggctggagcagtccagtgctttttgggctactttctgatgtgggccgccgtggtcggacttattccccggcctccggtggtggtgatgtgtcttttcatgttgctagcggcacatgctcagtcgttcttcaacacttctaatgccgtcactggtgtcagtaacttcccttattataaaggcaccattgttggcatcatgaaggtacttgaaattttgattccttcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MFS_1 Nodulin-like

Protein Analysis

160

Amino Acids

17.46

Weight (kDa)

8.7

Isoelectric Point (pI)

12.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Nodulin-like PF06813 12 - 152 2.6e-42 Nodulin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 429
AccB1I GGYRCC 2 cut(s) 80, 434
AccI GTMKAC 2 cut(s) 44, 102
AciI CCGC 3 cut(s) 78, 300, 362
AcsI RAATTY 1 cut(s) 465
AfaI GTAC 1 cut(s) 459
AfiI CCNNNNNNNGG 2 cut(s) 189, 328
AgsI TTSAA 3 cut(s) 169, 385, 464
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
Alw21I GWGCWC 1 cut(s) 74
Alw26I GTCTC 1 cut(s) 229
Alw44I GTGCAC 1 cut(s) 70
AoxI GGCC 2 cut(s) 297, 323
ApaLI GTGCAC 1 cut(s) 70
ApoI RAATTY 1 cut(s) 465
AspS9I GGNCC 2 cut(s) 236, 297
AsuC2I CCSGG 1 cut(s) 322
AsuHPI GGTGA 1 cut(s) 349
AsuNHI GCTAGC 1 cut(s) 358
AvaII GGWCC 1 cut(s) 236
BaeGI GKGCMC 1 cut(s) 74
BanI GGYRCC 2 cut(s) 80, 434
BauI CACGAG 1 cut(s) 226
Bbv12I GWGCWC 1 cut(s) 74
BceAI ACGGC 2 cut(s) 287, 383
BciVI GTATCC 1 cut(s) 57
BcnI CCSGG 1 cut(s) 322
BcoDI GTCTC 1 cut(s) 229
BfaI CTAG 2 cut(s) 9, 359
BfuI GTATCC 1 cut(s) 57
BisI GCNGC 3 cut(s) 79, 300, 363
BlsI GCNGC 3 cut(s) 80, 301, 364
Bme1390I CCNGG 1 cut(s) 322
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 2 cut(s) 236, 297
BmiI GGNNCC 3 cut(s) 82, 181, 436
BmrFI CCNGG 1 cut(s) 322
BmsI GCATC 1 cut(s) 456
BmtI GCTAGC 1 cut(s) 362
BpmI CTGGAG 1 cut(s) 279
BpuEI CTTGAG 1 cut(s) 101
BpuMI CCSGG 1 cut(s) 322
BsaJI CCNNGG 3 cut(s) 239, 303, 320
BsaWI WCCGGW 1 cut(s) 328
BsaXI ACNNNNNCTCC 2 cut(s) 80, 110
Bsc4I CCNNNNNNNGG 2 cut(s) 189, 328
Bse1I ACTGG 3 cut(s) 258, 268, 409
BseDI CCNNGG 3 cut(s) 239, 303, 320
BseLI CCNNNNNNNGG 2 cut(s) 189, 328
BseMII CTCAG 2 cut(s) 122, 386
BseNI ACTGG 3 cut(s) 258, 268, 409
BseSI GKGCMC 1 cut(s) 74
BshFI GGCC 2 cut(s) 299, 325
BshNI GGYRCC 2 cut(s) 80, 434
BsiHKAI GWGCWC 1 cut(s) 74
BsiSI CCGG 2 cut(s) 322, 329
BslI CCNNNNNNNGG 2 cut(s) 189, 328
BsmAI GTCTC 1 cut(s) 229
BsnI GGCC 2 cut(s) 299, 325
Bsp1286I GDGCHC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 136
BspACI CCGC 3 cut(s) 78, 300, 362
BspANI GGCC 2 cut(s) 299, 325
BspCNI CTCAG 2 cut(s) 121, 385
BspHI TCATGA 1 cut(s) 450
BspLI GGNNCC 3 cut(s) 82, 181, 436
BspOI GCTAGC 1 cut(s) 362
BspT107I GGYRCC 2 cut(s) 80, 434
BsrI ACTGG 3 cut(s) 258, 268, 409
BssECI CCNNGG 3 cut(s) 239, 303, 320
BssMI GATC 1 cut(s) 136
BssSI CACGAG 1 cut(s) 226
BssT1I CCWWGG 1 cut(s) 239
Bst2BI CACGAG 1 cut(s) 226
Bst4CI ACNGT 5 cut(s) 30, 49, 69, 157, 188
BstC8I GCNNGC 2 cut(s) 55, 360
BstDEI CTNAG 2 cut(s) 108, 372
BstDSI CCRYGG 1 cut(s) 303
BstKTI GATC 1 cut(s) 139
BstMAI GTCTC 1 cut(s) 229
BstMBI GATC 1 cut(s) 136
BstMWI GCNNNNNNNGC 3 cut(s) 78, 279, 368
BstNSI RCATGY 1 cut(s) 371
BstSCI CCNGG 1 cut(s) 320
BstSLI GKGCMC 1 cut(s) 74
BsuI GTATCC 1 cut(s) 57
BsuRI GGCC 2 cut(s) 299, 325
BtgI CCRYGG 1 cut(s) 303
BtsIMutI CAGTG 5 cut(s) 26, 74, 153, 275, 402
Cac8I GCNNGC 2 cut(s) 55, 360
CciI TCATGA 1 cut(s) 450
Cfr13I GGNCC 2 cut(s) 236, 297
Csp6I GTAC 1 cut(s) 458
CviAII CATG 3 cut(s) 352, 368, 451
CviJI RGCY 8 cut(s) 8, 132, 182, 233, 257, 282, 299, 325
CviKI_1 RGCY 8 cut(s) 8, 132, 182, 233, 257, 282, 299, 325
CviQI GTAC 1 cut(s) 458
DdeI CTNAG 2 cut(s) 108, 372
DpnI GATC 1 cut(s) 138
DpnII GATC 1 cut(s) 136
Eco130I CCWWGG 1 cut(s) 239
Eco47I GGWCC 1 cut(s) 236
EcoT14I CCWWGG 1 cut(s) 239
ErhI CCWWGG 1 cut(s) 239
FaeI CATG 3 cut(s) 355, 371, 454
FaiI YATR 8 cut(s) 59, 61, 88, 219, 353, 369, 429, 452
FatI CATG 3 cut(s) 351, 367, 450
FauNDI CATATG 1 cut(s) 59
FblI GTMKAC 2 cut(s) 44, 102
Fnu4HI GCNGC 3 cut(s) 79, 300, 363
Fsp4HI GCNGC 3 cut(s) 79, 300, 363
FspBI CTAG 2 cut(s) 9, 359
GluI GCNGC 3 cut(s) 79, 300, 363
GsuI CTGGAG 1 cut(s) 279
HaeIII GGCC 2 cut(s) 299, 325
HapII CCGG 2 cut(s) 322, 329
Hin1II CATG 3 cut(s) 355, 371, 454
HincII GTYRAC 1 cut(s) 144
HindII GTYRAC 1 cut(s) 144
HinfI GANTC 3 cut(s) 19, 193, 472
HpaII CCGG 2 cut(s) 322, 329
HphI GGTGA 1 cut(s) 349
Hpy166II GTNNAC 4 cut(s) 45, 72, 103, 144
Hpy188I TCNGA 4 cut(s) 24, 111, 291, 311
Hpy188III TCNNGA 4 cut(s) 118, 149, 451, 480
Hpy8I GTNNAC 4 cut(s) 45, 72, 103, 144
HpyAV CCTTC 2 cut(s) 103, 448
HpyCH4III ACNGT 5 cut(s) 30, 49, 69, 157, 188
HpyCH4V TGCA 1 cut(s) 72
HpyF10VI GCNNNNNNNGC 3 cut(s) 78, 279, 368
HpyF3I CTNAG 2 cut(s) 108, 372
Hsp92II CATG 3 cut(s) 355, 371, 454
Kzo9I GATC 1 cut(s) 136
LmnI GCTCC 2 cut(s) 179, 260
LweI GCATC 1 cut(s) 456
MaeI CTAG 2 cut(s) 9, 359
MaeIII GTNAC 2 cut(s) 400, 413
MalI GATC 1 cut(s) 138
MboI GATC 1 cut(s) 136
MboII GAAGA 1 cut(s) 373
MhlI GDGCHC 1 cut(s) 74
MluCI AATT 1 cut(s) 465
MmeI TCCRAC 1 cut(s) 289
MnlI CCTC 2 cut(s) 125, 336
MspA1I CMGCKG 1 cut(s) 78
MspI CCGG 2 cut(s) 322, 329
MspR9I CCNGG 1 cut(s) 322
MwoI GCNNNNNNNGC 3 cut(s) 78, 279, 368
NciI CCSGG 1 cut(s) 322
NdeI CATATG 1 cut(s) 59
NdeII GATC 1 cut(s) 136
NheI GCTAGC 1 cut(s) 358
NlaIII CATG 3 cut(s) 355, 371, 454
NlaIV GGNNCC 3 cut(s) 82, 181, 436
NmuCI GTSAC 1 cut(s) 400
NspI RCATGY 1 cut(s) 371
PagI TCATGA 1 cut(s) 450
PfeI GAWTC 3 cut(s) 19, 193, 472
PflFI GACNNNGTC 1 cut(s) 28
PkrI GCNGC 3 cut(s) 80, 301, 364
PsiI TTATAA 1 cut(s) 429
PspN4I GGNNCC 3 cut(s) 82, 181, 436
PspPI GGNCC 2 cut(s) 236, 297
PsyI GACNNNGTC 1 cut(s) 28
RsaI GTAC 1 cut(s) 459
RsaNI GTAC 1 cut(s) 458
SatI GCNGC 3 cut(s) 79, 300, 363
Sau3AI GATC 1 cut(s) 136
Sau96I GGNCC 2 cut(s) 236, 297
ScrFI CCNGG 1 cut(s) 322
SduI GDGCHC 1 cut(s) 74
SetI ASST 4 cut(s) 10, 95, 241, 459
SfaNI GCATC 1 cut(s) 456
SinI GGWCC 1 cut(s) 236
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 1 cut(s) 465
SsiI CCGC 3 cut(s) 78, 300, 362
SspMI CTAG 2 cut(s) 9, 359
StyD4I CCNGG 1 cut(s) 320
StyI CCWWGG 1 cut(s) 239
TaaI ACNGT 5 cut(s) 30, 49, 69, 157, 188
TaqI TCGA 1 cut(s) 150
TasI AATT 1 cut(s) 465
TauI GCSGC 3 cut(s) 81, 302, 365
TfiI GAWTC 3 cut(s) 19, 193, 472
TscAI CASTG 5 cut(s) 33, 74, 160, 275, 409
TseFI GTSAC 1 cut(s) 400
Tsp45I GTSAC 1 cut(s) 400
TspDTI ATGAA 2 cut(s) 340, 467
TspGWI ACGGA 1 cut(s) 88
TspRI CASTG 5 cut(s) 33, 74, 160, 275, 409
Tth111I GACNNNGTC 1 cut(s) 28
VneI GTGCAC 1 cut(s) 70
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 1 cut(s) 465
XceI RCATGY 1 cut(s) 371
XmiI GTMKAC 2 cut(s) 44, 102
XspI CTAG 2 cut(s) 9, 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.