Rmu_ssc0000114.1_g000008

Nodulation receptor kinase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000114.1
N/A
Physical Location & Seq
Reverse (-)
44892 .. 45819
928 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000114.1_g000008.1.cds

Sequence Viewer

Length: 228 bp
atggcattgaaaaatgaaggtattagttccttccttttagactttgctggaaatggggatctttcttctggcattcagagagggtctgatgaagaacgcaaacttataggaccatttcctaaaagcatcactaagctgactcacctaaaattcctgaacctcagcaacaatgggtttattggccaaattccagaatttcgtgaacgttccatgttgatttcagtgtaa

Protein Analysis

75

Amino Acids

8.28

Weight (kDa)

8.16

Isoelectric Point (pI)

19.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 205
AclWI GGATC 1 cut(s) 66
AcoI YGGCCR 1 cut(s) 181
AcsI RAATTY 3 cut(s) 149, 186, 194
AgsI TTSAA 1 cut(s) 10
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
AlwI GGATC 1 cut(s) 66
AoxI GGCC 1 cut(s) 181
ApoI RAATTY 3 cut(s) 149, 186, 194
AspS9I GGNCC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 134
AvaII GGWCC 1 cut(s) 110
BalI TGGCCA 1 cut(s) 183
BbvCI CCTCAGC 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BmsI GCATC 1 cut(s) 135
Bpu10I CCTNAGC 1 cut(s) 161
BseMII CTCAG 1 cut(s) 175
BshFI GGCC 1 cut(s) 183
BsmI GAATGC 1 cut(s) 72
BsnI GGCC 1 cut(s) 183
Bsp143I GATC 1 cut(s) 58
BspANI GGCC 1 cut(s) 183
BspCNI CTCAG 1 cut(s) 174
BspPI GGATC 1 cut(s) 66
BssMI GATC 1 cut(s) 58
BstDEI CTNAG 2 cut(s) 132, 161
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstX2I RGATCY 1 cut(s) 58
BstYI RGATCY 1 cut(s) 58
BsuRI GGCC 1 cut(s) 183
BtsIMutI CAGTG 1 cut(s) 228
Cfr13I GGNCC 1 cut(s) 110
CviAII CATG 1 cut(s) 211
CviJI RGCY 2 cut(s) 136, 183
CviKI_1 RGCY 2 cut(s) 136, 183
DdeI CTNAG 2 cut(s) 132, 161
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
EaeI YGGCCR 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 110
FaeI CATG 1 cut(s) 214
FaiI YATR 2 cut(s) 107, 212
FatI CATG 1 cut(s) 210
HaeIII GGCC 1 cut(s) 183
Hin1II CATG 1 cut(s) 214
HinfI GANTC 1 cut(s) 139
HphI GGTGA 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 2 cut(s) 78, 88
Hpy188III TCNNGA 3 cut(s) 154, 191, 200
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 2 cut(s) 11, 40
HpyCH4IV ACGT 1 cut(s) 205
HpyF3I CTNAG 2 cut(s) 132, 161
HpySE526I ACGT 1 cut(s) 205
Hsp92II CATG 1 cut(s) 214
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 4 cut(s) 33, 54, 167, 204
LweI GCATC 1 cut(s) 135
MaeII ACGT 1 cut(s) 205
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 2 cut(s) 57, 104
MflI RGATCY 1 cut(s) 58
MlsI TGGCCA 1 cut(s) 183
MluCI AATT 3 cut(s) 149, 186, 194
MluNI TGGCCA 1 cut(s) 183
MlyI GAGTC 1 cut(s) 133
MnlI CCTC 2 cut(s) 74, 170
Mox20I TGGCCA 1 cut(s) 183
MscI TGGCCA 1 cut(s) 183
Msp20I TGGCCA 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 72
NdeII GATC 1 cut(s) 58
NlaIII CATG 1 cut(s) 214
PctI GAATGC 1 cut(s) 72
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
Psp1406I AACGTT 1 cut(s) 205
PspPI GGNCC 1 cut(s) 110
PsuI RGATCY 1 cut(s) 58
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 1 cut(s) 110
SchI GAGTC 1 cut(s) 133
SetI ASST 5 cut(s) 22, 138, 147, 162, 208
SfaNI GCATC 1 cut(s) 135
SgeI CNNG 6 cut(s) 60, 81, 166, 203, 212, 223
SinI GGWCC 1 cut(s) 110
Sse9I AATT 3 cut(s) 149, 186, 194
TaiI ACGT 1 cut(s) 208
TasI AATT 3 cut(s) 149, 186, 194
TscAI CASTG 1 cut(s) 228
TspDTI ATGAA 2 cut(s) 30, 105
TspRI CASTG 1 cut(s) 228
VpaK11BI GGWCC 1 cut(s) 110
XapI RAATTY 3 cut(s) 149, 186, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.