Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000125.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

133630 .. 134329

Gene Structure 700 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 615 bp

atggtgcgtcagagtttggaggtcggtgagccatctggcttcgtgttgagtgctgcaacatctgtttggatgccagtatcaaggtcaaggctgtttgatttcttgcgagactggcaattaagggggcagtgggacattttggtcagctgtcgtccactgcaagccatggttcaggttgacaaggatcacggaggtggcaacagtgtttctctctttaatgccaagggtcttgatgccaataacaataataacatgctgatgttccaagagactaggacggatgcttcagggtcaatagttgtgtatgcaccgatcacttcaacaagttcagatatcatgagggatgttgtgtacgagggtggagattctacttatgtagaactcttaccatcaggatttgcaatccttccttgtgttacttctgaccatgtcaaaggagaaggaaatggctctgatgatgggggatgtctgctgacagttggattccaaattgtgtgtgatggtggccaaccaacatccaagctcactatgcactcggttaagactattattgatcttatctcctccaccattcagaagatcaaaagtgcccttcaaataaatgatggcccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox START

Protein Analysis

204

Amino Acids

21.96

Weight (kDa)

4.82

Isoelectric Point (pI)

38.95

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PDF2_C	PF25797	1 - 199	4.4e-63	PDF2-like, C-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	140
AclWI	GGATC	1 cut(s)	192
AcoI	YGGCCR	1 cut(s)	505
AcuI	CTGAAG	1 cut(s)	270
AfaI	GTAC	1 cut(s)	353
AgsI	TTSAA	2 cut(s)	321, 596
AleI	CACNNNNGTG	1 cut(s)	192
AluBI	AGCT	2 cut(s)	147, 523
AluI	AGCT	2 cut(s)	147, 523
Alw26I	GTCTC	2 cut(s)	102, 263
AlwI	GGATC	1 cut(s)	192
AoxI	GGCC	2 cut(s)	505, 607
ApeKI	GCWGC	1 cut(s)	53
AspS9I	GGNCC	1 cut(s)	608
AsuHPI	GGTGA	1 cut(s)	38
BaeGI	GKGCMC	1 cut(s)	592
BalI	TGGCCA	1 cut(s)	507
BbvI	GCAGC	1 cut(s)	40
BccI	CCATC	5 cut(s)	40, 397, 452, 494, 599
BcoDI	GTCTC	2 cut(s)	102, 263
BfaI	CTAG	1 cut(s)	273
BisI	GCNGC	1 cut(s)	54
BlsI	GCNGC	1 cut(s)	55
BmgT120I	GGNCC	1 cut(s)	608
BmsI	GCATC	3 cut(s)	60, 223, 271
BsaJI	CCNNGG	2 cut(s)	165, 222
Bse1I	ACTGG	2 cut(s)	74, 116
BseDI	CCNNGG	2 cut(s)	165, 222
BseGI	GGATG	5 cut(s)	75, 286, 349, 470, 515
BseNI	ACTGG	2 cut(s)	74, 116
BseRI	GAGGAG	1 cut(s)	553
BseSI	GKGCMC	1 cut(s)	592
BseXI	GCAGC	1 cut(s)	40
BshFI	GGCC	2 cut(s)	507, 609
BslFI	GGGAC	1 cut(s)	146
BsmAI	GTCTC	2 cut(s)	102, 263
BsmFI	GGGAC	1 cut(s)	146
BsnI	GGCC	2 cut(s)	507, 609
Bsp1286I	GDGCHC	1 cut(s)	592
Bsp143I	GATC	4 cut(s)	184, 312, 553, 579
Bsp19I	CCATGG	1 cut(s)	165
BspANI	GGCC	2 cut(s)	507, 609
BspHI	TCATGA	1 cut(s)	336
BspPI	GGATC	1 cut(s)	192
BsrI	ACTGG	2 cut(s)	74, 116
BssECI	CCNNGG	2 cut(s)	165, 222
BssMI	GATC	4 cut(s)	184, 312, 553, 579
BssT1I	CCWWGG	2 cut(s)	165, 222
Bst4CI	ACNGT	2 cut(s)	203, 478
BstC8I	GCNNGC	1 cut(s)	162
BstDSI	CCRYGG	1 cut(s)	165
BstF5I	GGATG	5 cut(s)	75, 286, 349, 470, 515
BstKTI	GATC	4 cut(s)	187, 315, 556, 582
BstMAI	GTCTC	2 cut(s)	102, 263
BstMBI	GATC	4 cut(s)	184, 312, 553, 579
BstMWI	GCNNNNNNNGC	2 cut(s)	112, 529
BstNSI	RCATGY	1 cut(s)	256
BstSLI	GKGCMC	1 cut(s)	592
BstV1I	GCAGC	1 cut(s)	40
BsuRI	GGCC	2 cut(s)	507, 609
BtgI	CCRYGG	1 cut(s)	165
BtsCI	GGATG	5 cut(s)	75, 286, 349, 470, 515
BtsI	GCAGTG	2 cut(s)	134, 155
BtsIMutI	CAGTG	3 cut(s)	134, 155, 208
Cac8I	GCNNGC	1 cut(s)	162
CciI	TCATGA	1 cut(s)	336
Cfr13I	GGNCC	1 cut(s)	608
Csp6I	GTAC	1 cut(s)	352
CviAII	CATG	4 cut(s)	166, 253, 337, 428
CviJI	RGCY	9 cut(s)	31, 39, 91, 147, 164, 450, 507, 523, 609
CviKI_1	RGCY	9 cut(s)	31, 39, 91, 147, 164, 450, 507, 523, 609
CviQI	GTAC	1 cut(s)	352
DpnI	GATC	4 cut(s)	186, 314, 555, 581
DpnII	GATC	4 cut(s)	184, 312, 553, 579
DrdI	GACNNNNNNGTC	1 cut(s)	140
DseDI	GACNNNNNNGTC	1 cut(s)	140
EaeI	YGGCCR	1 cut(s)	505
Eco130I	CCWWGG	2 cut(s)	165, 222
Eco32I	GATATC	1 cut(s)	334
Eco57I	CTGAAG	1 cut(s)	270
EcoRV	GATATC	1 cut(s)	334
EcoT14I	CCWWGG	2 cut(s)	165, 222
ErhI	CCWWGG	2 cut(s)	165, 222
FaeI	CATG	4 cut(s)	169, 256, 340, 431
FaiI	YATR	7 cut(s)	167, 254, 306, 338, 375, 429, 530
FaqI	GGGAC	1 cut(s)	146
FatI	CATG	4 cut(s)	165, 252, 336, 427
Fnu4HI	GCNGC	1 cut(s)	54
FokI	GGATG	5 cut(s)	82, 293, 356, 477, 502
Fsp4HI	GCNGC	1 cut(s)	54
FspBI	CTAG	1 cut(s)	273
GluI	GCNGC	1 cut(s)	54
HaeIII	GGCC	2 cut(s)	507, 609
Hin1II	CATG	4 cut(s)	169, 256, 340, 431
HincII	GTYRAC	1 cut(s)	178
HindII	GTYRAC	1 cut(s)	178
HinfI	GANTC	2 cut(s)	365, 483
HphI	GGTGA	1 cut(s)	38
Hpy166II	GTNNAC	3 cut(s)	155, 178, 352
Hpy188I	TCNGA	5 cut(s)	12, 331, 424, 454, 576
Hpy188III	TCNNGA	3 cut(s)	230, 337, 393
Hpy8I	GTNNAC	3 cut(s)	155, 178, 352
HpyAV	CCTTC	3 cut(s)	416, 434, 602
HpyCH4III	ACNGT	2 cut(s)	203, 478
HpyCH4V	TGCA	5 cut(s)	56, 160, 308, 401, 532
HpyF10VI	GCNNNNNNNGC	2 cut(s)	112, 529
Hsp92II	CATG	4 cut(s)	169, 256, 340, 431
Kzo9I	GATC	4 cut(s)	184, 312, 553, 579
LpnPI	CCDG	6 cut(s)	21, 87, 97, 158, 273, 378
Lsp1109I	GCAGC	1 cut(s)	40
LweI	GCATC	3 cut(s)	60, 223, 271
MaeI	CTAG	1 cut(s)	273
MaeIII	GTNAC	1 cut(s)	415
MalI	GATC	4 cut(s)	186, 314, 555, 581
MboI	GATC	4 cut(s)	184, 312, 553, 579
MboII	GAAGA	1 cut(s)	589
MhlI	GDGCHC	1 cut(s)	592
MlsI	TGGCCA	1 cut(s)	507
MluCI	AATT	2 cut(s)	116, 489
MluNI	TGGCCA	1 cut(s)	507
MmeI	TCCRAC	1 cut(s)	460
MnlI	CCTC	5 cut(s)	13, 185, 333, 349, 574
Mox20I	TGGCCA	1 cut(s)	507
MscI	TGGCCA	1 cut(s)	507
MseI	TTAA	3 cut(s)	119, 216, 540
MslI	CAYNNNNRTG	2 cut(s)	192, 257
Msp20I	TGGCCA	1 cut(s)	507
MspA1I	CMGCKG	1 cut(s)	147
MwoI	GCNNNNNNNGC	2 cut(s)	112, 529
NcoI	CCATGG	1 cut(s)	165
NdeII	GATC	4 cut(s)	184, 312, 553, 579
NlaIII	CATG	4 cut(s)	169, 256, 340, 431
NspI	RCATGY	1 cut(s)	256
OliI	CACNNNNGTG	1 cut(s)	192
PagI	TCATGA	1 cut(s)	336
PfeI	GAWTC	2 cut(s)	365, 483
PflFI	GACNNNGTC	1 cut(s)	428
PkrI	GCNGC	1 cut(s)	55
PspPI	GGNCC	1 cut(s)	608
PsyI	GACNNNGTC	1 cut(s)	428
PvuII	CAGCTG	1 cut(s)	147
RsaI	GTAC	1 cut(s)	353
RsaNI	GTAC	1 cut(s)	352
RseI	CAYNNNNRTG	2 cut(s)	192, 257
SaqAI	TTAA	3 cut(s)	119, 216, 540
SatI	GCNGC	1 cut(s)	54
Sau3AI	GATC	4 cut(s)	184, 312, 553, 579
Sau96I	GGNCC	1 cut(s)	608
SduI	GDGCHC	1 cut(s)	592
SetI	ASST	6 cut(s)	24, 86, 149, 177, 196, 525
SfaNI	GCATC	3 cut(s)	60, 223, 271
SmiMI	CAYNNNNRTG	2 cut(s)	192, 257
Sse9I	AATT	2 cut(s)	116, 489
SspMI	CTAG	1 cut(s)	273
StyI	CCWWGG	2 cut(s)	165, 222
TaaI	ACNGT	2 cut(s)	203, 478
TasI	AATT	2 cut(s)	116, 489
TfiI	GAWTC	2 cut(s)	365, 483
Tru1I	TTAA	3 cut(s)	119, 216, 540
Tru9I	TTAA	3 cut(s)	119, 216, 540
TscAI	CASTG	3 cut(s)	134, 162, 208
TseI	GCWGC	1 cut(s)	53
TspGWI	ACGGA	2 cut(s)	204, 293
TspRI	CASTG	3 cut(s)	134, 162, 208
Tth111I	GACNNNGTC	1 cut(s)	428
XceI	RCATGY	1 cut(s)	256
XspI	CTAG	1 cut(s)	273

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.