Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000165.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

43921 .. 44435

Gene Structure 515 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

atgtcagaggaagtgaagtctaagcatccaaggattacttatgcagacctgtaccagcttgctggtgttgttgctgttgaggtcactggaggccccaccattgattttactcctggcaggaaggattcaaaaatttctcccaaggaaggaagacttccagatgcaaaaagaggtctgttgcaataccttagatattttttgcaagttttatacaacctttgcaaatatattggtcgtccagtttcctttatactagcatcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000302 GO:0003674 GO:0003824 GO:0004130 GO:0004601 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005773 GO:0005774 GO:0005777 GO:0005778 GO:0005911 GO:0006950 GO:0006979 GO:0008150 GO:0008152 GO:0009056 GO:0009506 GO:0009507 GO:0009526 GO:0009536 GO:0009636 GO:0009719 GO:0009725 GO:0009735 GO:0009941 GO:0009987 GO:0010033 GO:0016020 GO:0016209 GO:0016491 GO:0016684 GO:0016688 GO:0016999 GO:0017001 GO:0017144 GO:0030054 GO:0031090 GO:0031903 GO:0031967 GO:0031975 GO:0033554 GO:0034599 GO:0042221 GO:0042579 GO:0042737 GO:0042743 GO:0042744 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044248 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044437 GO:0044438 GO:0044439 GO:0044444 GO:0044446 GO:0044464 GO:0050896 GO:0051186 GO:0051187 GO:0051716 GO:0055044 GO:0055114 GO:0070887 GO:0072593 GO:0097237 GO:0098588 GO:0098754 GO:0098805 GO:0098869 GO:1901700 GO:1990748

KEGG Pathways

Metabolic & Signaling

ko00053 ko00480 map00053 map00480

Pfam Domains

Protein Families

peroxidase

Protein Analysis

87

Amino Acids

9.78

Weight (kDa)

9.52

Isoelectric Point (pI)

43.87

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
peroxidase	PF00141	3 - 66	4.2e-11	Peroxidase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	132
AfaI	GTAC	1 cut(s)	53
AfiI	CCNNNNNNNGG	1 cut(s)	146
AgsI	TTSAA	1 cut(s)	129
AjnI	CCWGG	1 cut(s)	112
AluBI	AGCT	1 cut(s)	58
AluI	AGCT	1 cut(s)	58
AoxI	GGCC	1 cut(s)	91
ApoI	RAATTY	1 cut(s)	132
AspS9I	GGNCC	1 cut(s)	92
BbsI	GAAGAC	1 cut(s)	157
BciT130I	CCWGG	1 cut(s)	114
BfaI	CTAG	1 cut(s)	254
Bme1390I	CCNGG	1 cut(s)	114
BmgT120I	GGNCC	1 cut(s)	92
BmiI	GGNNCC	1 cut(s)	94
BmrFI	CCNGG	1 cut(s)	114
BmsI	GCATC	2 cut(s)	34, 151
BpiI	GAAGAC	1 cut(s)	157
BpmI	CTGGAG	1 cut(s)	108
BsaJI	CCNNGG	2 cut(s)	29, 141
Bsc4I	CCNNNNNNNGG	1 cut(s)	146
Bse1I	ACTGG	2 cut(s)	91, 239
BseBI	CCWGG	1 cut(s)	114
BseDI	CCNNGG	2 cut(s)	29, 141
BseGI	GGATG	1 cut(s)	25
BseLI	CCNNNNNNNGG	1 cut(s)	146
BseNI	ACTGG	2 cut(s)	91, 239
BshFI	GGCC	1 cut(s)	93
BslI	CCNNNNNNNGG	1 cut(s)	146
BsnI	GGCC	1 cut(s)	93
BspANI	GGCC	1 cut(s)	93
BspLI	GGNNCC	1 cut(s)	94
BsrI	ACTGG	2 cut(s)	91, 239
BssECI	CCNNGG	2 cut(s)	29, 141
BssT1I	CCWWGG	2 cut(s)	29, 141
Bst2UI	CCWGG	1 cut(s)	114
BstC8I	GCNNGC	1 cut(s)	60
BstDEI	CTNAG	2 cut(s)	21, 188
BstF5I	GGATG	1 cut(s)	25
BstNI	CCWGG	1 cut(s)	114
BstSCI	CCNGG	1 cut(s)	112
BstV2I	GAAGAC	1 cut(s)	157
BstXI	CCANNNNNNTGG	1 cut(s)	62
BsuRI	GGCC	1 cut(s)	93
BtsCI	GGATG	1 cut(s)	25
BtsIMutI	CAGTG	1 cut(s)	84
Cac8I	GCNNGC	1 cut(s)	60
Cfr13I	GGNCC	1 cut(s)	92
Csp6I	GTAC	1 cut(s)	52
CviJI	RGCY	2 cut(s)	58, 93
CviKI_1	RGCY	2 cut(s)	58, 93
CviQI	GTAC	1 cut(s)	52
DdeI	CTNAG	2 cut(s)	21, 188
Eco130I	CCWWGG	2 cut(s)	29, 141
EcoO109I	RGGNCCY	1 cut(s)	92
EcoRII	CCWGG	1 cut(s)	112
EcoT14I	CCWWGG	2 cut(s)	29, 141
ErhI	CCWWGG	2 cut(s)	29, 141
FaiI	YATR	4 cut(s)	42, 211, 228, 251
FalI	AAGNNNNNCTT	4 cut(s)	22, 54, 138, 170
FokI	GGATG	1 cut(s)	12
FspBI	CTAG	1 cut(s)	254
GsuI	CTGGAG	1 cut(s)	108
HaeIII	GGCC	1 cut(s)	93
HinfI	GANTC	1 cut(s)	125
Hpy188I	TCNGA	1 cut(s)	7
Hpy188III	TCNNGA	2 cut(s)	158, 261
HpyAV	CCTTC	2 cut(s)	115, 140
HpyCH4V	TGCA	5 cut(s)	44, 164, 181, 202, 222
HpyF3I	CTNAG	2 cut(s)	21, 188
LpnPI	CCDG	9 cut(s)	48, 62, 68, 72, 99, 103, 126, 171, 252
LweI	GCATC	2 cut(s)	34, 151
MaeI	CTAG	1 cut(s)	254
MaeIII	GTNAC	1 cut(s)	82
MboII	GAAGA	1 cut(s)	162
MluCI	AATT	1 cut(s)	132
MnlI	CCTC	3 cut(s)	73, 83, 164
MspR9I	CCNGG	1 cut(s)	114
MvaI	CCWGG	1 cut(s)	114
NlaIV	GGNNCC	1 cut(s)	94
NmuCI	GTSAC	1 cut(s)	82
PfeI	GAWTC	1 cut(s)	125
Psp6I	CCWGG	1 cut(s)	112
PspGI	CCWGG	1 cut(s)	112
PspN4I	GGNNCC	1 cut(s)	94
PspPI	GGNCC	1 cut(s)	92
RsaI	GTAC	1 cut(s)	53
RsaNI	GTAC	1 cut(s)	52
Sau96I	GGNCC	1 cut(s)	92
ScrFI	CCNGG	1 cut(s)	114
SetI	ASST	6 cut(s)	51, 60, 84, 175, 189, 219
SfaNI	GCATC	2 cut(s)	34, 151
Sse9I	AATT	1 cut(s)	132
SspMI	CTAG	1 cut(s)	254
StyD4I	CCNGG	1 cut(s)	112
StyI	CCWWGG	2 cut(s)	29, 141
TasI	AATT	1 cut(s)	132
TfiI	GAWTC	1 cut(s)	125
TscAI	CASTG	1 cut(s)	91
TseFI	GTSAC	1 cut(s)	82
Tsp45I	GTSAC	1 cut(s)	82
TspRI	CASTG	1 cut(s)	91
XapI	RAATTY	1 cut(s)	132
XspI	CTAG	1 cut(s)	254

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.