Rmu_ssc0000264.1_g000016

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000264.1
N/A
Physical Location & Seq
Forward (+)
62507 .. 62875
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000264.1_g000016.1.cds

Sequence Viewer

Length: 369 bp
atgtgtactttatataatttacagacgttgttgttgttcgcttgtggatctctagttgagttgccaactgatttgggaagattaatcaacttgcgtcatcttgatattagacacacaagtatagaaaagatgccaccaaggatgggcaaaatgaaagatctccaaacattaagaggtacgtttgtcctagacaaatgtactggtgataagattgtcgagattaaagagcttcagcagttgcgaggaacactttgtatctgggggcttcgcaatattgtgcatgtcacagatgccattatgagaaagaagaagcatctggatgaattagttttggtatggggaggcaagtcttgtgacaccgacgcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

13.9

Weight (kDa)

8.9

Isoelectric Point (pI)

51.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 55
AcuI CTGAAG 1 cut(s) 215
AcyI GRCGYC 1 cut(s) 363
AfaI GTAC 3 cut(s) 7, 178, 199
AfiI CCNNNNNNNGG 1 cut(s) 143
AluBI AGCT 1 cut(s) 229
AluI AGCT 1 cut(s) 229
AlwI GGATC 1 cut(s) 55
AseI ATTAAT 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 215
BaeI ACNNNNGTAYC 2 cut(s) 168, 201
BccI CCATC 1 cut(s) 136
BfaI CTAG 2 cut(s) 53, 188
BglII AGATCT 1 cut(s) 157
BmsI GCATC 3 cut(s) 120, 280, 322
BsaHI GRCGYC 1 cut(s) 363
BsaJI CCNNGG 1 cut(s) 137
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 205
BseDI CCNNGG 1 cut(s) 137
BseGI GGATG 2 cut(s) 147, 325
BseLI CCNNNNNNNGG 1 cut(s) 143
BseNI ACTGG 1 cut(s) 205
BslI CCNNNNNNNGG 1 cut(s) 143
Bsp143I GATC 2 cut(s) 47, 157
BspPI GGATC 1 cut(s) 55
BsrI ACTGG 1 cut(s) 205
BssECI CCNNGG 1 cut(s) 137
BssMI GATC 2 cut(s) 47, 157
BssNI GRCGYC 1 cut(s) 363
BssT1I CCWWGG 1 cut(s) 137
BstACI GRCGYC 1 cut(s) 363
BstF5I GGATG 2 cut(s) 147, 325
BstKTI GATC 2 cut(s) 50, 160
BstMBI GATC 2 cut(s) 47, 157
BstNSI RCATGY 1 cut(s) 284
BstX2I RGATCY 2 cut(s) 47, 157
BstYI RGATCY 2 cut(s) 47, 157
BtsCI GGATG 2 cut(s) 147, 325
CseI GACGC 1 cut(s) 83
Csp6I GTAC 3 cut(s) 6, 177, 198
CviAII CATG 1 cut(s) 281
CviJI RGCY 2 cut(s) 229, 265
CviKI_1 RGCY 2 cut(s) 229, 265
CviQI GTAC 3 cut(s) 6, 177, 198
DpnI GATC 2 cut(s) 49, 159
DpnII GATC 2 cut(s) 47, 157
Eco130I CCWWGG 1 cut(s) 137
Eco57I CTGAAG 1 cut(s) 215
EcoT14I CCWWGG 1 cut(s) 137
ErhI CCWWGG 1 cut(s) 137
FaeI CATG 1 cut(s) 284
FaiI YATR 6 cut(s) 13, 15, 122, 282, 299, 337
FatI CATG 1 cut(s) 280
FokI GGATG 2 cut(s) 154, 332
FspBI CTAG 2 cut(s) 53, 188
HgaI GACGC 1 cut(s) 83
Hin1I GRCGYC 1 cut(s) 363
Hin1II CATG 1 cut(s) 284
HphI GGTGA 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 3 cut(s) 101, 217, 317
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 365
HpyCH4IV ACGT 2 cut(s) 26, 179
HpyCH4V TGCA 1 cut(s) 280
HpySE526I ACGT 2 cut(s) 26, 179
Hsp92I GRCGYC 1 cut(s) 363
Hsp92II CATG 1 cut(s) 284
Kzo9I GATC 2 cut(s) 47, 157
LpnPI CCDG 3 cut(s) 186, 244, 302
LweI GCATC 3 cut(s) 120, 280, 322
MaeI CTAG 2 cut(s) 53, 188
MaeII ACGT 2 cut(s) 26, 179
MaeIII GTNAC 2 cut(s) 283, 353
MalI GATC 2 cut(s) 49, 159
MboI GATC 2 cut(s) 47, 157
MboII GAAGA 2 cut(s) 90, 319
MflI RGATCY 2 cut(s) 47, 157
MluCI AATT 2 cut(s) 16, 323
MnlI CCTC 3 cut(s) 167, 236, 335
MseI TTAA 3 cut(s) 83, 170, 222
MslI CAYNNNNRTG 1 cut(s) 318
NdeII GATC 2 cut(s) 47, 157
NlaIII CATG 1 cut(s) 284
NmuCI GTSAC 2 cut(s) 283, 353
NspI RCATGY 1 cut(s) 284
PshBI ATTAAT 1 cut(s) 83
PsuI RGATCY 2 cut(s) 47, 157
RsaI GTAC 3 cut(s) 7, 178, 199
RsaNI GTAC 3 cut(s) 6, 177, 198
RseI CAYNNNNRTG 1 cut(s) 318
SaqAI TTAA 3 cut(s) 83, 170, 222
Sau3AI GATC 2 cut(s) 47, 157
SetI ASST 4 cut(s) 29, 178, 182, 231
SfaNI GCATC 3 cut(s) 120, 280, 322
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 2 cut(s) 16, 323
SspI AATATT 1 cut(s) 274
SspMI CTAG 2 cut(s) 53, 188
StyI CCWWGG 1 cut(s) 137
TaiI ACGT 2 cut(s) 29, 182
TaqI TCGA 1 cut(s) 216
TasI AATT 2 cut(s) 16, 323
TatI WGTACW 2 cut(s) 5, 197
Tru1I TTAA 3 cut(s) 83, 170, 222
Tru9I TTAA 3 cut(s) 83, 170, 222
TseFI GTSAC 2 cut(s) 283, 353
Tsp45I GTSAC 2 cut(s) 283, 353
TspDTI ATGAA 2 cut(s) 167, 336
VspI ATTAAT 1 cut(s) 83
XceI RCATGY 1 cut(s) 284
XspI CTAG 2 cut(s) 53, 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.