Rmu_ssc0000429.1_g000001

Belongs to the eukaryotic ribosomal protein eS6 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000429.1
N/A
Physical Location & Seq
Reverse (-)
209 .. 913
705 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 348 bp
atgagaggtccaaagagggcttccaagattcgcaagctatttaacctcaccaaggaggatgatgttcggaagtatgtcaacacttaccgcagaaaattcacatccaaaactggcaagaattgcagcaaagctcccaaaattcagaggctggttactcctttgactttacagaggaagcgagcaaggattgcagagaagaagaagagagttgtaaaggccaagtcagaggctgcagagtatcagaagttacttgcttccaggttgaaggagcagcgtgagcgccgcagtgagagcttagccaagaagagatcaagactctcctctgccaccaagccatctgctgcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko01521 ko03010 ko04066 ko04150 ko04151 ko04371 ko04714 ko04910 ko05205 map01521 map03010 map04066 map04150 map04151 map04371 map04714 map04910 map05205
Pfam Domains
Protein Families
Ribosomal_S6e

Protein Analysis

115

Amino Acids

13.36

Weight (kDa)

11.46

Isoelectric Point (pI)

47.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 88, 283
AcsI RAATTY 2 cut(s) 95, 138
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 265
AjnI CCWGG 1 cut(s) 257
AjuI GAANNNNNNNTTGG 1 cut(s) 36
AluBI AGCT 3 cut(s) 37, 131, 294
AluI AGCT 3 cut(s) 37, 131, 294
AlwNI CAGNNNCTG 2 cut(s) 148, 230
AoxI GGCC 1 cut(s) 216
ApeKI GCWGC 4 cut(s) 123, 230, 271, 341
ApoI RAATTY 2 cut(s) 95, 138
AspLEI GCGC 1 cut(s) 282
AspS9I GGNCC 1 cut(s) 8
AsuHPI GGTGA 1 cut(s) 40
AvaII GGWCC 1 cut(s) 8
BbvI GCAGC 4 cut(s) 135, 217, 283, 328
BccI CCATC 1 cut(s) 343
BciT130I CCWGG 1 cut(s) 259
BfmI CTRYAG 1 cut(s) 231
BfoI RGCGCY 1 cut(s) 283
BisI GCNGC 5 cut(s) 124, 231, 272, 283, 342
BlpI GCTNAGC 1 cut(s) 295
BlsI GCNGC 5 cut(s) 125, 232, 273, 284, 343
Bme1390I CCNGG 1 cut(s) 259
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmrFI CCNGG 1 cut(s) 259
Bpu1102I GCTNAGC 1 cut(s) 295
BsaJI CCNNGG 1 cut(s) 51
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 259
BseDI CCNNGG 1 cut(s) 51
BseGI GGATG 2 cut(s) 64, 101
BseLI CCNNNNNNNGG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 115
BseRI GAGGAG 1 cut(s) 310
BseXI GCAGC 4 cut(s) 135, 217, 283, 328
BshFI GGCC 1 cut(s) 218
BslI CCNNNNNNNGG 1 cut(s) 52
BsnI GGCC 1 cut(s) 218
Bsp143I GATC 1 cut(s) 308
Bsp1720I GCTNAGC 1 cut(s) 295
BspACI CCGC 2 cut(s) 88, 283
BspANI GGCC 1 cut(s) 218
BspMAI CTGCAG 1 cut(s) 235
BsrI ACTGG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 1 cut(s) 308
BssT1I CCWWGG 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 259
Bst6I CTCTTC 2 cut(s) 197, 299
BstAPI GCANNNNNTGC 2 cut(s) 120, 188
BstC8I GCNNGC 2 cut(s) 35, 180
BstDEI CTNAG 2 cut(s) 295, 345
BstENI CCTNNNNNAGG 1 cut(s) 50
BstF5I GGATG 2 cut(s) 64, 101
BstH2I RGCGCY 1 cut(s) 283
BstHHI GCGC 1 cut(s) 282
BstKTI GATC 1 cut(s) 311
BstMBI GATC 1 cut(s) 308
BstMWI GCNNNNNNNGC 4 cut(s) 120, 188, 277, 291
BstNI CCWGG 1 cut(s) 259
BstSCI CCNGG 1 cut(s) 257
BstSFI CTRYAG 1 cut(s) 231
BstV1I GCAGC 4 cut(s) 135, 217, 283, 328
BsuRI GGCC 1 cut(s) 218
BtsCI GGATG 2 cut(s) 64, 101
BtsI GCAGTG 1 cut(s) 292
BtsIMutI CAGTG 1 cut(s) 292
Cac8I GCNNGC 2 cut(s) 35, 180
CaiI CAGNNNCTG 2 cut(s) 148, 230
CfoI GCGC 1 cut(s) 282
Cfr13I GGNCC 1 cut(s) 8
CviJI RGCY 9 cut(s) 20, 37, 131, 148, 218, 230, 294, 299, 334
CviKI_1 RGCY 9 cut(s) 20, 37, 131, 148, 218, 230, 294, 299, 334
DdeI CTNAG 2 cut(s) 295, 345
DpnI GATC 1 cut(s) 310
DpnII GATC 1 cut(s) 308
Eam1104I CTCTTC 2 cut(s) 197, 299
EarI CTCTTC 2 cut(s) 197, 299
Eco130I CCWWGG 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 8
EcoNI CCTNNNNNAGG 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 257
EcoT14I CCWWGG 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 51
FaiI YATR 1 cut(s) 75
Fnu4HI GCNGC 5 cut(s) 124, 231, 272, 283, 342
FokI GGATG 2 cut(s) 71, 88
Fsp4HI GCNGC 5 cut(s) 124, 231, 272, 283, 342
GlaI GCGC 1 cut(s) 281
GluI GCNGC 5 cut(s) 124, 231, 272, 283, 342
HaeII RGCGCY 1 cut(s) 283
HaeIII GGCC 1 cut(s) 218
HhaI GCGC 1 cut(s) 282
Hin6I GCGC 1 cut(s) 280
HinP1I GCGC 1 cut(s) 280
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HinfI GANTC 2 cut(s) 28, 315
HphI GGTGA 1 cut(s) 40
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 4 cut(s) 69, 144, 226, 243
Hpy188III TCNNGA 1 cut(s) 312
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 259
HpyCH4V TGCA 3 cut(s) 123, 191, 233
HpyF10VI GCNNNNNNNGC 4 cut(s) 120, 188, 277, 291
HpyF3I CTNAG 2 cut(s) 295, 345
HspAI GCGC 1 cut(s) 280
Kzo9I GATC 1 cut(s) 308
LmnI GCTCC 2 cut(s) 136, 268
LpnPI CCDG 4 cut(s) 96, 134, 244, 271
Lsp1109I GCAGC 4 cut(s) 135, 217, 283, 328
MaeIII GTNAC 2 cut(s) 151, 246
MalI GATC 1 cut(s) 310
MboI GATC 1 cut(s) 308
MboII GAAGA 4 cut(s) 208, 211, 214, 316
MluCI AATT 3 cut(s) 95, 118, 138
MlyI GAGTC 1 cut(s) 309
MnlI CCTC 7 cut(s) 9, 49, 56, 138, 165, 220, 331
MseI TTAA 1 cut(s) 42
MspR9I CCNGG 1 cut(s) 259
MvaI CCWGG 1 cut(s) 259
MwoI GCNNNNNNNGC 4 cut(s) 120, 188, 277, 291
NdeII GATC 1 cut(s) 308
PfeI GAWTC 1 cut(s) 28
PkrI GCNGC 5 cut(s) 125, 232, 273, 284, 343
PleI GAGTC 1 cut(s) 309
PpsI GAGTC 1 cut(s) 309
Psp6I CCWGG 1 cut(s) 257
PspGI CCWGG 1 cut(s) 257
PspPI GGNCC 1 cut(s) 8
PstI CTGCAG 1 cut(s) 235
PstNI CAGNNNCTG 2 cut(s) 148, 230
SaqAI TTAA 1 cut(s) 42
SatI GCNGC 5 cut(s) 124, 231, 272, 283, 342
Sau3AI GATC 1 cut(s) 308
Sau96I GGNCC 1 cut(s) 8
SchI GAGTC 1 cut(s) 309
ScrFI CCNGG 1 cut(s) 259
SetI ASST 6 cut(s) 10, 39, 48, 133, 263, 296
SfcI CTRYAG 1 cut(s) 231
SinI GGWCC 1 cut(s) 8
Sse9I AATT 3 cut(s) 95, 118, 138
SsiI CCGC 2 cut(s) 88, 283
StyD4I CCNGG 1 cut(s) 257
StyI CCWWGG 1 cut(s) 51
TasI AATT 3 cut(s) 95, 118, 138
TauI GCSGC 1 cut(s) 285
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 1 cut(s) 292
TseI GCWGC 4 cut(s) 123, 230, 271, 341
TspRI CASTG 1 cut(s) 292
VpaK11BI GGWCC 1 cut(s) 8
XagI CCTNNNNNAGG 1 cut(s) 50
XapI RAATTY 2 cut(s) 95, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.