Rroxscaffold_1G00011330

disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Forward (+)
14302557 .. 14305191
2635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00011330.1

Sequence Viewer

Length: 564 bp
ATGACTACTTGCATGATACTGATGCCAAGTACGTCATGCTTCTTGCTTTGCTGTCTATTCCCAGAAGATGATGATATCCCAATAGAAAACTTGATTAAGTATGGGTTAGGGAAAGGATTGTTTCGAGATGTCAACACAAACCAAACAATTCAAAAAGCTAAAGCCAAAATGTACATGGTGGTCAAGCATCTTGTAGCTTCTAACTTGCTTTTGAATGGTACACGGGATGGAAGTGTAAGGATGCATGATGTCATTCGAGATATGGCTATGTCAATTGCTTTGTCAGAAGATGGACGTGGGTTTTTGGTAAGAACTCGTTGTGAATTAAGAGACTGGCCAATGGATGCACATGATTGCTACTCAGCAATCTCGCTAATGGAGAACAACATTAGCAAGCTTCCCAAAGAGTTGGTAAGTTCAGAACTGCAGATTTTATTGCTAAATAGAAATGCTGATATGAAAGAGATCCCAGATTCATTTTTTCAAACTCCGAATGCATTAAGGGTCTTAGATCTCAGTGAAACATTGACTAACTTAACCTTGACTAAATGGCGTACAAGTTGA

Protein Analysis

187

Amino Acids

21.22

Weight (kDa)

5.92

Isoelectric Point (pI)

42.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 460
AcoI YGGCCR 1 cut(s) 335
AfaI GTAC 4 cut(s) 31, 173, 220, 556
AgsI TTSAA 3 cut(s) 152, 214, 485
AjiI CACGTC 1 cut(s) 296
AluBI AGCT 3 cut(s) 158, 197, 397
AluI AGCT 3 cut(s) 158, 197, 397
Alw26I GTCTC 1 cut(s) 324
AlwI GGATC 1 cut(s) 460
AoxI GGCC 1 cut(s) 335
BalI TGGCCA 1 cut(s) 337
BccI CCATC 2 cut(s) 221, 284
BcoDI GTCTC 1 cut(s) 324
BfmI CTRYAG 1 cut(s) 425
BglII AGATCT 1 cut(s) 511
BmgBI CACGTC 1 cut(s) 296
BmsI GCATC 4 cut(s) 12, 196, 231, 334
Bse1I ACTGG 1 cut(s) 338
BseGI GGATG 3 cut(s) 232, 246, 349
BseMII CTCAG 2 cut(s) 375, 529
BseNI ACTGG 1 cut(s) 338
BshFI GGCC 1 cut(s) 337
BsmAI GTCTC 1 cut(s) 324
BsmI GAATGC 1 cut(s) 499
BsnI GGCC 1 cut(s) 337
Bsp1407I TGTACA 1 cut(s) 171
Bsp143I GATC 2 cut(s) 465, 511
BspANI GGCC 1 cut(s) 337
BspCNI CTCAG 2 cut(s) 374, 528
BspMAI CTGCAG 1 cut(s) 429
BspPI GGATC 1 cut(s) 460
BsrGI TGTACA 1 cut(s) 171
BsrI ACTGG 1 cut(s) 338
BssMI GATC 2 cut(s) 465, 511
BstAUI TGTACA 1 cut(s) 171
BstC8I GCNNGC 1 cut(s) 395
BstDEI CTNAG 3 cut(s) 361, 508, 515
BstF5I GGATG 3 cut(s) 232, 246, 349
BstKTI GATC 2 cut(s) 468, 514
BstMAI GTCTC 1 cut(s) 324
BstMBI GATC 2 cut(s) 465, 511
BstSFI CTRYAG 1 cut(s) 425
BstX2I RGATCY 2 cut(s) 465, 511
BstXI CCANNNNNNTGG 1 cut(s) 409
BstYI RGATCY 2 cut(s) 465, 511
BsuRI GGCC 1 cut(s) 337
BtrI CACGTC 1 cut(s) 296
BtsCI GGATG 3 cut(s) 232, 246, 349
BtsIMutI CAGTG 1 cut(s) 523
Cac8I GCNNGC 1 cut(s) 395
Csp6I GTAC 4 cut(s) 30, 172, 219, 555
CviAII CATG 5 cut(s) 13, 36, 175, 245, 350
CviJI RGCY 6 cut(s) 158, 164, 197, 266, 337, 397
CviKI_1 RGCY 6 cut(s) 158, 164, 197, 266, 337, 397
CviQI GTAC 4 cut(s) 30, 172, 219, 555
DdeI CTNAG 3 cut(s) 361, 508, 515
DpnI GATC 2 cut(s) 467, 513
DpnII GATC 2 cut(s) 465, 511
EaeI YGGCCR 1 cut(s) 335
Eco32I GATATC 1 cut(s) 76
EcoRV GATATC 1 cut(s) 76
EcoT22I ATGCAT 2 cut(s) 246, 499
FaeI CATG 5 cut(s) 16, 39, 178, 248, 353
FaiI YATR 9 cut(s) 14, 37, 102, 176, 246, 263, 269, 351, 458
FatI CATG 5 cut(s) 12, 35, 174, 244, 349
FokI GGATG 3 cut(s) 239, 253, 356
HaeIII GGCC 1 cut(s) 337
Hin1II CATG 5 cut(s) 16, 39, 178, 248, 353
HincII GTYRAC 1 cut(s) 133
HindII GTYRAC 1 cut(s) 133
HindIII AAGCTT 1 cut(s) 395
HinfI GANTC 1 cut(s) 473
Hpy166II GTNNAC 2 cut(s) 133, 221
Hpy188I TCNGA 3 cut(s) 286, 421, 492
Hpy188III TCNNGA 2 cut(s) 125, 257
Hpy8I GTNNAC 2 cut(s) 133, 221
HpyCH4IV ACGT 2 cut(s) 32, 295
HpyCH4V TGCA 5 cut(s) 12, 244, 347, 427, 497
HpyF3I CTNAG 3 cut(s) 361, 508, 515
HpySE526I ACGT 2 cut(s) 32, 295
Hsp92II CATG 5 cut(s) 16, 39, 178, 248, 353
Kzo9I GATC 2 cut(s) 465, 511
LpnPI CCDG 3 cut(s) 75, 319, 483
LweI GCATC 4 cut(s) 12, 196, 231, 334
MaeII ACGT 2 cut(s) 32, 295
MalI GATC 2 cut(s) 467, 513
MboI GATC 2 cut(s) 465, 511
MboII GAAGA 2 cut(s) 77, 299
MfeI CAATTG 1 cut(s) 273
MflI RGATCY 2 cut(s) 465, 511
MlsI TGGCCA 1 cut(s) 337
MluCI AATT 3 cut(s) 147, 273, 323
MluNI TGGCCA 1 cut(s) 337
Mox20I TGGCCA 1 cut(s) 337
Mph1103I ATGCAT 2 cut(s) 246, 499
MscI TGGCCA 1 cut(s) 337
MseI TTAA 4 cut(s) 96, 326, 500, 536
Msp20I TGGCCA 1 cut(s) 337
MunI CAATTG 1 cut(s) 273
Mva1269I GAATGC 1 cut(s) 499
NdeII GATC 2 cut(s) 465, 511
NlaIII CATG 5 cut(s) 16, 39, 178, 248, 353
NsiI ATGCAT 2 cut(s) 246, 499
PctI GAATGC 1 cut(s) 499
PfeI GAWTC 1 cut(s) 473
PstI CTGCAG 1 cut(s) 429
PsuI RGATCY 2 cut(s) 465, 511
RsaI GTAC 4 cut(s) 31, 173, 220, 556
RsaNI GTAC 4 cut(s) 30, 172, 219, 555
SaqAI TTAA 4 cut(s) 96, 326, 500, 536
Sau3AI GATC 2 cut(s) 465, 511
SetI ASST 6 cut(s) 35, 160, 199, 298, 399, 542
SfaNI GCATC 4 cut(s) 12, 196, 231, 334
SfcI CTRYAG 1 cut(s) 425
Sse9I AATT 3 cut(s) 147, 273, 323
TaiI ACGT 2 cut(s) 35, 298
TaqI TCGA 2 cut(s) 124, 256
TasI AATT 3 cut(s) 147, 273, 323
TatI WGTACW 1 cut(s) 171
TfiI GAWTC 1 cut(s) 473
Tru1I TTAA 4 cut(s) 96, 326, 500, 536
Tru9I TTAA 4 cut(s) 96, 326, 500, 536
TscAI CASTG 1 cut(s) 523
TspDTI ATGAA 2 cut(s) 465, 473
TspRI CASTG 1 cut(s) 523
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
Zsp2I ATGCAT 2 cut(s) 246, 499
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.