Rroxscaffold_1G00015880
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Forward (+)
19771000 .. 19772446
1447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00015880.1

Sequence Viewer

Length: 222 bp
ATGCTACCAATGGTTTTAGCTCAGAATTTGGTTGGGAAAGGAGGATATGCAGAGGTGTATAGAAGTGTTCTGAAAGGTAATGAGGAAATTGCTGTGAAGAGGATCACAAAAACTATGACTAATGAAAGGGAAGAGAAGGAGTTCTCGAATGAGATTAGATCATTAGAACTATTGGCCATGTTGCCATCCAAATGTGTTGTCACTTGTGGGTTGTTGCATTGA

Protein Analysis

73

Amino Acids

8.18

Weight (kDa)

7.78

Isoelectric Point (pI)

35.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 9 - 59 9.3e-06 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AcoI YGGCCR 1 cut(s) 174
AcsI RAATTY 1 cut(s) 25
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
AlwI GGATC 1 cut(s) 110
AoxI GGCC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 25
ArsI GACNNNNNNTTYG 2 cut(s) 183, 215
Asp700I GAANNNNTTC 1 cut(s) 140
BalI TGGCCA 1 cut(s) 176
BccI CCATC 1 cut(s) 193
BseGI GGATG 1 cut(s) 185
BseMII CTCAG 1 cut(s) 35
BshFI GGCC 1 cut(s) 176
BsnI GGCC 1 cut(s) 176
Bsp143I GATC 2 cut(s) 102, 158
BspANI GGCC 1 cut(s) 176
BspCNI CTCAG 1 cut(s) 34
BspPI GGATC 1 cut(s) 110
BssMI GATC 2 cut(s) 102, 158
Bst6I CTCTTC 2 cut(s) 92, 126
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 185
BstKTI GATC 2 cut(s) 105, 161
BstMBI GATC 2 cut(s) 102, 158
BsuRI GGCC 1 cut(s) 176
BtsCI GGATG 1 cut(s) 185
CviAII CATG 1 cut(s) 178
CviJI RGCY 2 cut(s) 20, 176
CviKI_1 RGCY 2 cut(s) 20, 176
DdeI CTNAG 1 cut(s) 21
DpnI GATC 2 cut(s) 104, 160
DpnII GATC 2 cut(s) 102, 158
EaeI YGGCCR 1 cut(s) 174
Eam1104I CTCTTC 2 cut(s) 92, 126
EarI CTCTTC 2 cut(s) 92, 126
FaeI CATG 1 cut(s) 181
FaiI YATR 4 cut(s) 48, 60, 116, 179
FatI CATG 1 cut(s) 177
FokI GGATG 1 cut(s) 172
HaeIII GGCC 1 cut(s) 176
Hin1II CATG 1 cut(s) 181
Hpy188I TCNGA 2 cut(s) 24, 72
Hpy188III TCNNGA 1 cut(s) 145
HpyAV CCTTC 1 cut(s) 130
HpyCH4V TGCA 2 cut(s) 50, 217
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 1 cut(s) 181
Kzo9I GATC 2 cut(s) 102, 158
MaeIII GTNAC 1 cut(s) 199
MalI GATC 2 cut(s) 104, 160
MboI GATC 2 cut(s) 102, 158
MboII GAAGA 2 cut(s) 109, 143
MlsI TGGCCA 1 cut(s) 176
MluCI AATT 2 cut(s) 25, 87
MluNI TGGCCA 1 cut(s) 176
MnlI CCTC 4 cut(s) 35, 46, 76, 93
Mox20I TGGCCA 1 cut(s) 176
MroXI GAANNNNTTC 1 cut(s) 140
MscI TGGCCA 1 cut(s) 176
MslI CAYNNNNRTG 1 cut(s) 190
Msp20I TGGCCA 1 cut(s) 176
NdeII GATC 2 cut(s) 102, 158
NlaIII CATG 1 cut(s) 181
NmuCI GTSAC 1 cut(s) 199
PdmI GAANNNNTTC 1 cut(s) 140
RseI CAYNNNNRTG 1 cut(s) 190
Sau3AI GATC 2 cut(s) 102, 158
SetI ASST 3 cut(s) 22, 57, 79
SgeI CNNG 3 cut(s) 157, 190, 216
SmiMI CAYNNNNRTG 1 cut(s) 190
Sse9I AATT 2 cut(s) 25, 87
TaqI TCGA 1 cut(s) 146
TasI AATT 2 cut(s) 25, 87
TseFI GTSAC 1 cut(s) 199
Tsp45I GTSAC 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 138
XapI RAATTY 1 cut(s) 25
XmnI GAANNNNTTC 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.