Rroxscaffold_1G00016270
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Reverse (-)
20277768 .. 20282869
5102 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00016270.1

Sequence Viewer

Length: 360 bp
ATGCTCGGTGATGTTAGAGGCAATAACCGACAGCACGATCACCGACTACATTGGCAACTGTACAAGCTTTGGGATCCCGATCGATCACCGGCTCTTCCTGTCTTGGATTTAAGTGAGAATGAACTTGTTGGGCCAACTCCACCGATACTAGGCAATTTATCGTACATTGGGAAACTATACTCGCATGGTAACAAGTTGATCGGGACTATTCCTCCCGAGCTTGGCAATATGCCCCGACGAGACACCGGCCCGAGTCGGCTGACTCACGGGCCTTATGTCGAGTTCGACTACGGCCCCCCACTACCGAAGGAGAAAACTGCCTCAAAAAGATGTAAGCATGCTTTGCCATTAACTCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04016 map04016
Pfam Domains
Protein Families
LRRNT_2 LRR_4 LRR_6 LRR_8 Pkinase

Protein Analysis

119

Amino Acids

13.39

Weight (kDa)

9.13

Isoelectric Point (pI)

41.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 68, 81
AfaI GTAC 2 cut(s) 62, 164
AfiI CCNNNNNNNGG 2 cut(s) 149, 221
AluBI AGCT 2 cut(s) 67, 220
AluI AGCT 2 cut(s) 67, 220
Alw26I GTCTC 1 cut(s) 234
AlwI GGATC 2 cut(s) 68, 81
Ama87I CYCGRG 2 cut(s) 215, 250
AoxI GGCC 4 cut(s) 131, 247, 269, 292
AspS9I GGNCC 4 cut(s) 131, 248, 269, 293
AsuHPI GGTGA 3 cut(s) 20, 32, 78
AvaI CYCGRG 2 cut(s) 215, 250
BamHI GGATCC 1 cut(s) 73
BceAI ACGGC 1 cut(s) 307
BcoDI GTCTC 1 cut(s) 234
BfaI CTAG 2 cut(s) 149, 358
BmeT110I CYCGRG 2 cut(s) 215, 250
BmgT120I GGNCC 4 cut(s) 131, 248, 269, 293
BmiI GGNNCC 2 cut(s) 75, 295
Bsa29I ATCGAT 1 cut(s) 82
BsaBI GATNNNNATC 1 cut(s) 78
BsaXI ACNNNNNCTCC 2 cut(s) 196, 226
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 221
Bse118I RCCGGY 2 cut(s) 88, 245
Bse8I GATNNNNATC 1 cut(s) 78
BseCI ATCGAT 1 cut(s) 82
BseJI GATNNNNATC 1 cut(s) 78
BseLI CCNNNNNNNGG 2 cut(s) 149, 221
Bsh1285I CGRYCG 1 cut(s) 82
BshFI GGCC 4 cut(s) 133, 249, 271, 294
BshVI ATCGAT 1 cut(s) 82
BsiEI CGRYCG 1 cut(s) 82
BsiHKCI CYCGRG 2 cut(s) 215, 250
BsiSI CCGG 2 cut(s) 89, 246
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 2 cut(s) 149, 221
BsmAI GTCTC 1 cut(s) 234
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 4 cut(s) 133, 249, 271, 294
BsoBI CYCGRG 2 cut(s) 215, 250
Bsp1407I TGTACA 1 cut(s) 60
Bsp143I GATC 5 cut(s) 37, 73, 79, 83, 198
BspANI GGCC 4 cut(s) 133, 249, 271, 294
BspDI ATCGAT 1 cut(s) 82
BspLI GGNNCC 2 cut(s) 75, 295
BspPI GGATC 2 cut(s) 68, 81
BspQI GCTCTTC 1 cut(s) 99
BsrFI RCCGGY 2 cut(s) 88, 245
BsrGI TGTACA 1 cut(s) 60
BssAI RCCGGY 2 cut(s) 88, 245
BssMI GATC 5 cut(s) 37, 73, 79, 83, 198
Bst4CI ACNGT 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 99
BstAPI GCANNNNNTGC 1 cut(s) 343
BstAUI TGTACA 1 cut(s) 60
BstC8I GCNNGC 1 cut(s) 339
BstKTI GATC 5 cut(s) 40, 76, 82, 86, 201
BstMAI GTCTC 1 cut(s) 234
BstMBI GATC 5 cut(s) 37, 73, 79, 83, 198
BstMCI CGRYCG 1 cut(s) 82
BstMWI GCNNNNNNNGC 1 cut(s) 343
BstNSI RCATGY 1 cut(s) 341
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
Bsu15I ATCGAT 1 cut(s) 82
BsuRI GGCC 4 cut(s) 133, 249, 271, 294
BsuTUI ATCGAT 1 cut(s) 82
Cac8I GCNNGC 1 cut(s) 339
Cfr10I RCCGGY 2 cut(s) 88, 245
Cfr13I GGNCC 4 cut(s) 131, 248, 269, 293
ClaI ATCGAT 1 cut(s) 82
Csp6I GTAC 2 cut(s) 61, 163
CviAII CATG 2 cut(s) 185, 338
CviJI RGCY 8 cut(s) 67, 92, 133, 220, 249, 259, 271, 294
CviKI_1 RGCY 8 cut(s) 67, 92, 133, 220, 249, 259, 271, 294
CviQI GTAC 2 cut(s) 61, 163
DpnI GATC 5 cut(s) 39, 75, 81, 85, 200
DpnII GATC 5 cut(s) 37, 73, 79, 83, 198
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco88I CYCGRG 2 cut(s) 215, 250
FaeI CATG 2 cut(s) 188, 341
FaiI YATR 5 cut(s) 178, 186, 230, 276, 339
FaqI GGGAC 1 cut(s) 217
FatI CATG 2 cut(s) 184, 337
FspBI CTAG 2 cut(s) 149, 358
HaeIII GGCC 4 cut(s) 133, 249, 271, 294
HapII CCGG 2 cut(s) 89, 246
Hin1II CATG 2 cut(s) 188, 341
HindIII AAGCTT 1 cut(s) 65
HinfI GANTC 2 cut(s) 253, 262
HpaII CCGG 2 cut(s) 89, 246
HphI GGTGA 3 cut(s) 20, 32, 78
Hpy188III TCNNGA 3 cut(s) 77, 202, 215
Hpy99I CGWCG 1 cut(s) 240
HpyAV CCTTC 1 cut(s) 301
HpyCH4III ACNGT 1 cut(s) 60
HpyF10VI GCNNNNNNNGC 1 cut(s) 343
Hsp92II CATG 2 cut(s) 188, 341
Kzo9I GATC 5 cut(s) 37, 73, 79, 83, 198
LguI GCTCTTC 1 cut(s) 99
LpnPI CCDG 3 cut(s) 102, 111, 259
MaeI CTAG 2 cut(s) 149, 358
MaeIII GTNAC 1 cut(s) 188
MalI GATC 5 cut(s) 39, 75, 81, 85, 200
MboI GATC 5 cut(s) 37, 73, 79, 83, 198
MboII GAAGA 1 cut(s) 86
MflI RGATCY 1 cut(s) 73
MluCI AATT 1 cut(s) 154
MlyI GAGTC 2 cut(s) 256, 262
MnlI CCTC 3 cut(s) 11, 222, 331
MseI TTAA 2 cut(s) 110, 350
MspI CCGG 2 cut(s) 89, 246
MwoI GCNNNNNNNGC 1 cut(s) 343
NdeII GATC 5 cut(s) 37, 73, 79, 83, 198
NlaIII CATG 2 cut(s) 188, 341
NlaIV GGNNCC 2 cut(s) 75, 295
NspI RCATGY 1 cut(s) 341
PaeI GCATGC 1 cut(s) 341
PciSI GCTCTTC 1 cut(s) 99
Ple19I CGATCG 1 cut(s) 82
PleI GAGTC 2 cut(s) 256, 261
PpsI GAGTC 2 cut(s) 256, 261
PspN4I GGNNCC 2 cut(s) 75, 295
PspPI GGNCC 4 cut(s) 131, 248, 269, 293
PsuI RGATCY 1 cut(s) 73
PvuI CGATCG 1 cut(s) 82
RsaI GTAC 2 cut(s) 62, 164
RsaNI GTAC 2 cut(s) 61, 163
SapI GCTCTTC 1 cut(s) 99
SaqAI TTAA 2 cut(s) 110, 350
Sau3AI GATC 5 cut(s) 37, 73, 79, 83, 198
Sau96I GGNCC 4 cut(s) 131, 248, 269, 293
SchI GAGTC 2 cut(s) 256, 262
SetI ASST 2 cut(s) 69, 222
SphI GCATGC 1 cut(s) 341
Sse9I AATT 1 cut(s) 154
SspMI CTAG 2 cut(s) 149, 358
TaaI ACNGT 1 cut(s) 60
TaqI TCGA 3 cut(s) 82, 279, 285
TasI AATT 1 cut(s) 154
TatI WGTACW 1 cut(s) 60
Tru1I TTAA 2 cut(s) 110, 350
Tru9I TTAA 2 cut(s) 110, 350
TspDTI ATGAA 1 cut(s) 135
XceI RCATGY 1 cut(s) 341
XspI CTAG 2 cut(s) 149, 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.