Rroxscaffold_1G00032000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Reverse (-)
45458753 .. 45459122
370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00032000.1

Sequence Viewer

Length: 255 bp
ATGAGGCTTCTTGGCGACCGGCTCGAGCACCGGCCACGGGGATCGAGTCAATGTCCACCTTGTCCGATACGATGCGTTTCACTTACCTCATGCGTAGACGGGGAATTCACATGTGTACCAAGACTTCGGGATCTAGCCTTTTCTGCGGACATTAGGTATTCAAATCTAGAAGGGAGGCCTGGACTATCGTCGGTGGAGGGGTCTTGGAGCCGAATGCCATTCAAGCAACAAATGCGTGGCTCGAGAGGGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase

Protein Analysis

84

Amino Acids

9.37

Weight (kDa)

9.4

Isoelectric Point (pI)

33.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 96
AciI CCGC 1 cut(s) 146
AclWI GGATC 2 cut(s) 49, 138
AcoI YGGCCR 1 cut(s) 32
AcsI RAATTY 1 cut(s) 104
AfaI GTAC 1 cut(s) 117
AfiI CCNNNNNNNGG 1 cut(s) 37
AflIII ACRYGT 1 cut(s) 110
AgsI TTSAA 2 cut(s) 162, 223
AjnI CCWGG 1 cut(s) 178
Alw21I GWGCWC 1 cut(s) 30
AlwI GGATC 2 cut(s) 49, 138
Ama87I CYCGRG 2 cut(s) 23, 241
AoxI GGCC 2 cut(s) 32, 176
ApoI RAATTY 1 cut(s) 104
AvaI CYCGRG 2 cut(s) 23, 241
BaeI ACNNNNGTAYC 2 cut(s) 99, 132
BarI GAAGNNNNNNTAC 2 cut(s) 108, 140
Bbv12I GWGCWC 1 cut(s) 30
BciT130I CCWGG 1 cut(s) 180
BfaI CTAG 2 cut(s) 134, 167
Bme1390I CCNGG 1 cut(s) 180
BmeT110I CYCGRG 2 cut(s) 23, 241
BmiI GGNNCC 1 cut(s) 209
BmrFI CCNGG 1 cut(s) 180
BmsI GCATC 1 cut(s) 62
BoxI GACNNNNGTC 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 37
Bse118I RCCGGY 2 cut(s) 18, 30
BseBI CCWGG 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 37
Bsh1285I CGRYCG 1 cut(s) 19
BshFI GGCC 2 cut(s) 34, 178
BsiEI CGRYCG 1 cut(s) 19
BsiHKAI GWGCWC 1 cut(s) 30
BsiHKCI CYCGRG 2 cut(s) 23, 241
BsiSI CCGG 2 cut(s) 19, 31
BslI CCNNNNNNNGG 1 cut(s) 37
BsmI GAATGC 1 cut(s) 219
BsnI GGCC 2 cut(s) 34, 178
BsoBI CYCGRG 2 cut(s) 23, 241
Bsp1286I GDGCHC 1 cut(s) 30
Bsp143I GATC 2 cut(s) 41, 130
BspACI CCGC 1 cut(s) 146
BspANI GGCC 2 cut(s) 34, 178
BspLI GGNNCC 1 cut(s) 209
BspPI GGATC 2 cut(s) 49, 138
BsrFI RCCGGY 2 cut(s) 18, 30
BssAI RCCGGY 2 cut(s) 18, 30
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 2 cut(s) 41, 130
Bst2UI CCWGG 1 cut(s) 180
BstAPI GCANNNNNTGC 1 cut(s) 232
BstDSI CCRYGG 1 cut(s) 35
BstKTI GATC 2 cut(s) 44, 133
BstMBI GATC 2 cut(s) 41, 130
BstMCI CGRYCG 1 cut(s) 19
BstMWI GCNNNNNNNGC 3 cut(s) 143, 223, 232
BstNI CCWGG 1 cut(s) 180
BstNSI RCATGY 1 cut(s) 114
BstPAI GACNNNNGTC 1 cut(s) 187
BstSCI CCNGG 1 cut(s) 178
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
BsuRI GGCC 2 cut(s) 34, 178
BtgI CCRYGG 1 cut(s) 35
Cfr10I RCCGGY 2 cut(s) 18, 30
Csp6I GTAC 1 cut(s) 116
CviAII CATG 2 cut(s) 90, 111
CviJI RGCY 8 cut(s) 7, 22, 34, 137, 178, 210, 240, 251
CviKI_1 RGCY 8 cut(s) 7, 22, 34, 137, 178, 210, 240, 251
CviQI GTAC 1 cut(s) 116
DpnI GATC 2 cut(s) 43, 132
DpnII GATC 2 cut(s) 41, 130
EaeI YGGCCR 1 cut(s) 32
Eco147I AGGCCT 1 cut(s) 178
Eco88I CYCGRG 2 cut(s) 23, 241
EcoRI GAATTC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 178
FaeI CATG 2 cut(s) 93, 114
FaiI YATR 2 cut(s) 91, 112
FatI CATG 2 cut(s) 89, 110
FblI GTMKAC 1 cut(s) 96
FspBI CTAG 2 cut(s) 134, 167
HaeIII GGCC 2 cut(s) 34, 178
HapII CCGG 2 cut(s) 19, 31
Hin1II CATG 2 cut(s) 93, 114
HinfI GANTC 1 cut(s) 46
HpaII CCGG 2 cut(s) 19, 31
Hpy166II GTNNAC 3 cut(s) 56, 97, 116
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 3 cut(s) 128, 167, 243
Hpy8I GTNNAC 3 cut(s) 56, 97, 116
Hpy99I CGWCG 1 cut(s) 193
HpyAV CCTTC 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 3 cut(s) 143, 223, 232
Hsp92II CATG 2 cut(s) 93, 114
Kzo9I GATC 2 cut(s) 41, 130
LmnI GCTCC 1 cut(s) 207
LpnPI CCDG 4 cut(s) 32, 44, 165, 192
LweI GCATC 1 cut(s) 62
MaeI CTAG 2 cut(s) 134, 167
MalI GATC 2 cut(s) 43, 132
MboI GATC 2 cut(s) 41, 130
MflI RGATCY 1 cut(s) 130
MhlI GDGCHC 1 cut(s) 30
MluCI AATT 1 cut(s) 104
MlyI GAGTC 1 cut(s) 55
MnlI CCTC 4 cut(s) 97, 168, 190, 239
MseI TTAA 1 cut(s) 253
MspI CCGG 2 cut(s) 19, 31
MspR9I CCNGG 1 cut(s) 180
Mva1269I GAATGC 1 cut(s) 219
MvaI CCWGG 1 cut(s) 180
MwoI GCNNNNNNNGC 3 cut(s) 143, 223, 232
NdeII GATC 2 cut(s) 41, 130
NlaIII CATG 2 cut(s) 93, 114
NlaIV GGNNCC 1 cut(s) 209
NspI RCATGY 1 cut(s) 114
PaeR7I CTCGAG 2 cut(s) 23, 241
PceI AGGCCT 1 cut(s) 178
PciI ACATGT 1 cut(s) 110
PctI GAATGC 1 cut(s) 219
PleI GAGTC 1 cut(s) 54
PpsI GAGTC 1 cut(s) 54
PscI ACATGT 1 cut(s) 110
PshAI GACNNNNGTC 1 cut(s) 187
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 209
PspXI VCTCGAGB 1 cut(s) 23
PsuI RGATCY 1 cut(s) 130
RsaI GTAC 1 cut(s) 117
RsaNI GTAC 1 cut(s) 116
SaqAI TTAA 1 cut(s) 253
Sau3AI GATC 2 cut(s) 41, 130
SchI GAGTC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 180
SduI GDGCHC 1 cut(s) 30
SetI ASST 3 cut(s) 61, 89, 158
SfaNI GCATC 1 cut(s) 62
Sfr274I CTCGAG 2 cut(s) 23, 241
SlaI CTCGAG 2 cut(s) 23, 241
SmlI CTYRAG 2 cut(s) 23, 241
SmoI CTYRAG 2 cut(s) 23, 241
Sse9I AATT 1 cut(s) 104
SseBI AGGCCT 1 cut(s) 178
SsiI CCGC 1 cut(s) 146
SspMI CTAG 2 cut(s) 134, 167
StuI AGGCCT 1 cut(s) 178
StyD4I CCNGG 1 cut(s) 178
TaqI TCGA 3 cut(s) 24, 44, 242
TasI AATT 1 cut(s) 104
Tru1I TTAA 1 cut(s) 253
Tru9I TTAA 1 cut(s) 253
XapI RAATTY 1 cut(s) 104
XbaI TCTAGA 1 cut(s) 166
XceI RCATGY 1 cut(s) 114
XhoI CTCGAG 2 cut(s) 23, 241
XmiI GTMKAC 1 cut(s) 96
XspI CTAG 2 cut(s) 134, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.