Rroxscaffold_1G00047990

L-type lectin-domain containing receptor kinase IX.1-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Reverse (-)
67979928 .. 67986511
6584 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00047990.1

Sequence Viewer

Length: 303 bp
ATGACCTTGCTCTCTGTCTTCTTCCTAACTATCTCAGTCTGTACCGAAAATGAAAGCATTGATGATCATGTGGGAATTGATGTCAACGCTCTCAAGTCCTTGACCACCACACCTTGGCATGGTGGTATTGAGAAAGGAAAACTCAATAGTGCTATGGGGTCTGAACAAGGGCTTAAGGAGTATGCAGCAAAAGTAAGGATTATCGATCGACTTGGGCATCGAAATTTAGTGCAACTCATTAGTTGGTTCACGAAAAAAGACAACTCCTACTCATTTACGAGTTCATGCCCAATGGTAGCCTAG

Protein Analysis

100

Amino Acids

11.06

Weight (kDa)

6.81

Isoelectric Point (pI)

28.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 114
AcsI RAATTY 1 cut(s) 223
AfaI GTAC 1 cut(s) 43
AfiI CCNNNNNNNGG 2 cut(s) 114, 119
AflII CTTAAG 1 cut(s) 173
ApeKI GCWGC 1 cut(s) 185
ApoI RAATTY 1 cut(s) 223
BbsI GAAGAC 1 cut(s) 10
BbvI GCAGC 1 cut(s) 197
BclI TGATCA 1 cut(s) 64
BfaI CTAG 1 cut(s) 301
BfrI CTTAAG 1 cut(s) 173
BisI GCNGC 1 cut(s) 186
BlsI GCNGC 1 cut(s) 187
BmsI GCATC 1 cut(s) 226
BpiI GAAGAC 1 cut(s) 10
BpuEI CTTGAG 1 cut(s) 77
Bsa29I ATCGAT 1 cut(s) 204
BsaJI CCNNGG 1 cut(s) 113
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 119
BseCI ATCGAT 1 cut(s) 204
BseDI CCNNGG 1 cut(s) 113
BseLI CCNNNNNNNGG 2 cut(s) 114, 119
BseMII CTCAG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 197
Bsh1285I CGRYCG 1 cut(s) 208
BshVI ATCGAT 1 cut(s) 204
BsiEI CGRYCG 1 cut(s) 208
BslI CCNNNNNNNGG 2 cut(s) 114, 119
Bsp143I GATC 2 cut(s) 64, 205
BspCNI CTCAG 1 cut(s) 47
BspDI ATCGAT 1 cut(s) 204
BspTI CTTAAG 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 113
BssMI GATC 2 cut(s) 64, 205
BssT1I CCWWGG 1 cut(s) 113
BstAFI CTTAAG 1 cut(s) 173
BstDEI CTNAG 1 cut(s) 34
BstKTI GATC 2 cut(s) 67, 208
BstMBI GATC 2 cut(s) 64, 205
BstMCI CGRYCG 1 cut(s) 208
BstV1I GCAGC 1 cut(s) 197
BstV2I GAAGAC 1 cut(s) 10
Bsu15I ATCGAT 1 cut(s) 204
BsuTUI ATCGAT 1 cut(s) 204
ClaI ATCGAT 1 cut(s) 204
Csp6I GTAC 1 cut(s) 42
CviAII CATG 3 cut(s) 68, 119, 285
CviJI RGCY 2 cut(s) 172, 299
CviKI_1 RGCY 2 cut(s) 172, 299
CviQI GTAC 1 cut(s) 42
DdeI CTNAG 1 cut(s) 34
DpnI GATC 2 cut(s) 66, 207
DpnII GATC 2 cut(s) 64, 205
Eco130I CCWWGG 1 cut(s) 113
EcoT14I CCWWGG 1 cut(s) 113
ErhI CCWWGG 1 cut(s) 113
FaeI CATG 3 cut(s) 71, 122, 288
FaiI YATR 5 cut(s) 69, 120, 155, 183, 286
FatI CATG 3 cut(s) 67, 118, 284
FbaI TGATCA 1 cut(s) 64
Fnu4HI GCNGC 1 cut(s) 186
Fsp4HI GCNGC 1 cut(s) 186
FspBI CTAG 1 cut(s) 301
GluI GCNGC 1 cut(s) 186
Hin1II CATG 3 cut(s) 71, 122, 288
HincII GTYRAC 1 cut(s) 85
HindII GTYRAC 1 cut(s) 85
Hpy166II GTNNAC 2 cut(s) 85, 249
Hpy188I TCNGA 1 cut(s) 163
Hpy188III TCNNGA 1 cut(s) 250
Hpy8I GTNNAC 2 cut(s) 85, 249
HpyCH4V TGCA 2 cut(s) 185, 232
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 3 cut(s) 71, 122, 288
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 2 cut(s) 64, 205
Lsp1109I GCAGC 1 cut(s) 197
LweI GCATC 1 cut(s) 226
MaeI CTAG 1 cut(s) 301
MalI GATC 2 cut(s) 66, 207
MboI GATC 2 cut(s) 64, 205
MboII GAAGA 2 cut(s) 10, 13
MluCI AATT 2 cut(s) 75, 223
MseI TTAA 1 cut(s) 174
MspCI CTTAAG 1 cut(s) 173
NdeII GATC 2 cut(s) 64, 205
NlaIII CATG 3 cut(s) 71, 122, 288
PflMI CCANNNNNTGG 1 cut(s) 114
PkrI GCNGC 1 cut(s) 187
Ple19I CGATCG 1 cut(s) 208
PvuI CGATCG 1 cut(s) 208
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 186
Sau3AI GATC 2 cut(s) 64, 205
SetI ASST 2 cut(s) 8, 115
SfaNI GCATC 1 cut(s) 226
SmlI CTYRAG 2 cut(s) 92, 173
SmoI CTYRAG 2 cut(s) 92, 173
Sse9I AATT 2 cut(s) 75, 223
SspMI CTAG 1 cut(s) 301
StyI CCWWGG 1 cut(s) 113
TaqI TCGA 3 cut(s) 204, 208, 220
TasI AATT 2 cut(s) 75, 223
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 1 cut(s) 185
TspDTI ATGAA 2 cut(s) 66, 273
Van91I CCANNNNNTGG 1 cut(s) 114
Vha464I CTTAAG 1 cut(s) 173
XapI RAATTY 1 cut(s) 223
XspI CTAG 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.