Rroxscaffold_1G00070450

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Forward (+)
91363421 .. 91365848
2428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00070450.1

Sequence Viewer

Length: 393 bp
ATGCCATGGAAGGAACATTTTCTGAGAAATCTGATATCTTCAGTTTTGGAGTTAGAGATTGTTAGCAGCAGGAGGAACAGAAACCCTGATTATCATGAGAAACATCTAAACCTGATTGGTTATGTATGTGCCCTCCTTATATTGAATCGGAAATACCTCACTTCAGTCTTCTTCTATGTTGCATATTTCATAAAATATTTAAATGTTTCAGGCATGGCATTTGTGGAAGGAAGGCACGCTAGGGCCCTTGAGTTGACTGATGAAGCATCGGCAGCCTCATTTTCCTCATCAGAAGTTACAAGATGCATACAGGTTGCGCTTATGTTCAAGACCATGCCATGGATAAGCCAACCATACGAGATGAACATGGAGTTTAAGTTGGAGCGTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

130

Amino Acids

15.23

Weight (kDa)

8.58

Isoelectric Point (pI)

36.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 339
AcuI CTGAAG 2 cut(s) 24, 147
AfiI CCNNNNNNNGG 1 cut(s) 339
AgsI TTSAA 2 cut(s) 145, 328
AoxI GGCC 1 cut(s) 243
ApaI GGGCCC 1 cut(s) 247
ApeKI GCWGC 2 cut(s) 66, 272
Asp700I GAANNNNTTC 1 cut(s) 18
AspLEI GCGC 1 cut(s) 319
AspS9I GGNCC 2 cut(s) 243, 244
BaeGI GKGCMC 2 cut(s) 133, 247
BanII GRGCYC 1 cut(s) 247
BbsI GAAGAC 1 cut(s) 160
BbvI GCAGC 2 cut(s) 78, 284
BfaI CTAG 1 cut(s) 240
BisI GCNGC 2 cut(s) 67, 273
BlsI GCNGC 2 cut(s) 68, 274
BmgT120I GGNCC 2 cut(s) 243, 244
BmiI GGNNCC 1 cut(s) 245
BmsI GCATC 2 cut(s) 275, 293
BpiI GAAGAC 1 cut(s) 160
BpuEI CTTGAG 1 cut(s) 269
BsaJI CCNNGG 2 cut(s) 5, 338
BsaXI ACNNNNNCTCC 2 cut(s) 362, 392
Bsc4I CCNNNNNNNGG 1 cut(s) 339
BseDI CCNNGG 2 cut(s) 5, 338
BseLI CCNNNNNNNGG 1 cut(s) 339
BseMII CTCAG 1 cut(s) 14
BseSI GKGCMC 2 cut(s) 133, 247
BseXI GCAGC 2 cut(s) 78, 284
BshFI GGCC 1 cut(s) 245
BslI CCNNNNNNNGG 1 cut(s) 339
BsnI GGCC 1 cut(s) 245
Bsp120I GGGCCC 1 cut(s) 243
Bsp1286I GDGCHC 2 cut(s) 133, 247
Bsp19I CCATGG 2 cut(s) 5, 338
BspANI GGCC 1 cut(s) 245
BspCNI CTCAG 1 cut(s) 15
BspHI TCATGA 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 245
BssECI CCNNGG 2 cut(s) 5, 338
BssT1I CCWWGG 2 cut(s) 5, 338
BstC8I GCNNGC 2 cut(s) 237, 387
BstDEI CTNAG 1 cut(s) 23
BstDSI CCRYGG 2 cut(s) 5, 338
BstHHI GCGC 1 cut(s) 319
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstSLI GKGCMC 2 cut(s) 133, 247
BstV1I GCAGC 2 cut(s) 78, 284
BstV2I GAAGAC 1 cut(s) 160
BsuRI GGCC 1 cut(s) 245
BtgI CCRYGG 2 cut(s) 5, 338
Cac8I GCNNGC 2 cut(s) 237, 387
CciI TCATGA 1 cut(s) 94
CfoI GCGC 1 cut(s) 319
Cfr13I GGNCC 2 cut(s) 243, 244
CviAII CATG 6 cut(s) 6, 95, 214, 334, 339, 367
CviJI RGCY 3 cut(s) 245, 275, 348
CviKI_1 RGCY 3 cut(s) 245, 275, 348
DdeI CTNAG 1 cut(s) 23
DraI TTTAAA 1 cut(s) 201
Eco130I CCWWGG 2 cut(s) 5, 338
Eco24I GRGCYC 1 cut(s) 247
Eco32I GATATC 1 cut(s) 36
Eco57I CTGAAG 2 cut(s) 24, 147
EcoO109I RGGNCCY 2 cut(s) 243, 244
EcoRV GATATC 1 cut(s) 36
EcoT14I CCWWGG 2 cut(s) 5, 338
EcoT22I ATGCAT 1 cut(s) 308
EcoT38I GRGCYC 1 cut(s) 247
ErhI CCWWGG 2 cut(s) 5, 338
FaeI CATG 6 cut(s) 9, 98, 217, 337, 342, 370
FatI CATG 6 cut(s) 5, 94, 213, 333, 338, 366
Fnu4HI GCNGC 2 cut(s) 67, 273
FriOI GRGCYC 1 cut(s) 247
Fsp4HI GCNGC 2 cut(s) 67, 273
FspBI CTAG 1 cut(s) 240
GlaI GCGC 1 cut(s) 318
GluI GCNGC 2 cut(s) 67, 273
HaeIII GGCC 1 cut(s) 245
HhaI GCGC 1 cut(s) 319
Hin1II CATG 6 cut(s) 9, 98, 217, 337, 342, 370
Hin6I GCGC 1 cut(s) 317
HinP1I GCGC 1 cut(s) 317
HincII GTYRAC 1 cut(s) 255
HindII GTYRAC 1 cut(s) 255
HinfI GANTC 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 255
Hpy188I TCNGA 4 cut(s) 24, 33, 150, 292
Hpy188III TCNNGA 2 cut(s) 95, 328
Hpy8I GTNNAC 1 cut(s) 255
HpyAV CCTTC 3 cut(s) 4, 221, 225
HpyCH4V TGCA 3 cut(s) 182, 306, 389
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
HpyF3I CTNAG 1 cut(s) 23
Hsp92II CATG 6 cut(s) 9, 98, 217, 337, 342, 370
HspAI GCGC 1 cut(s) 317
LmnI GCTCC 1 cut(s) 382
LpnPI CCDG 5 cut(s) 55, 99, 125, 195, 296
Lsp1109I GCAGC 2 cut(s) 78, 284
LweI GCATC 2 cut(s) 275, 293
MaeI CTAG 1 cut(s) 240
MaeIII GTNAC 1 cut(s) 295
MboII GAAGA 3 cut(s) 30, 160, 163
MhlI GDGCHC 2 cut(s) 133, 247
MmeI TCCRAC 1 cut(s) 360
MnlI CCTC 5 cut(s) 66, 143, 167, 286, 295
Mph1103I ATGCAT 1 cut(s) 308
MroXI GAANNNNTTC 1 cut(s) 18
MseI TTAA 2 cut(s) 200, 375
MwoI GCNNNNNNNGC 1 cut(s) 272
NcoI CCATGG 2 cut(s) 5, 338
NlaIII CATG 6 cut(s) 9, 98, 217, 337, 342, 370
NlaIV GGNNCC 1 cut(s) 245
NsiI ATGCAT 1 cut(s) 308
PagI TCATGA 1 cut(s) 94
PdmI GAANNNNTTC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 145
PflMI CCANNNNNTGG 1 cut(s) 339
PkrI GCNGC 2 cut(s) 68, 274
PspN4I GGNNCC 1 cut(s) 245
PspOMI GGGCCC 1 cut(s) 243
PspPI GGNCC 2 cut(s) 243, 244
SaqAI TTAA 2 cut(s) 200, 375
SatI GCNGC 2 cut(s) 67, 273
Sau96I GGNCC 2 cut(s) 243, 244
SduI GDGCHC 2 cut(s) 133, 247
SetI ASST 3 cut(s) 114, 159, 315
SfaNI GCATC 2 cut(s) 275, 293
SmiI ATTTAAAT 1 cut(s) 201
SmlI CTYRAG 1 cut(s) 248
SmoI CTYRAG 1 cut(s) 248
SspI AATATT 1 cut(s) 197
SspMI CTAG 1 cut(s) 240
StyI CCWWGG 2 cut(s) 5, 338
SwaI ATTTAAAT 1 cut(s) 201
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 2 cut(s) 200, 375
Tru9I TTAA 2 cut(s) 200, 375
TseI GCWGC 2 cut(s) 66, 272
TspDTI ATGAA 3 cut(s) 178, 276, 377
Van91I CCANNNNNTGG 1 cut(s) 339
XmnI GAANNNNTTC 1 cut(s) 18
XspI CTAG 1 cut(s) 240
Zsp2I ATGCAT 1 cut(s) 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.