Rroxscaffold_1G00070560

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Reverse (-)
91474035 .. 91475154
1120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00070560.1

Sequence Viewer

Length: 150 bp
ATGTTAAGTGGTGAAGCATCTCCACCATCTCCTCAACAACCAGCATTCGTTTTCAAAAAGCTTTCTAGCCATGATGCCGATCCATTGCTTCCAAAAGGATTATATTATGCTGTGAATAGCTTGACAATTAGTAGAGAGGAAGGTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

49

Amino Acids

5.36

Weight (kDa)

5.54

Isoelectric Point (pI)

69.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AgsI TTSAA 1 cut(s) 55
AluBI AGCT 2 cut(s) 61, 120
AluI AGCT 2 cut(s) 61, 120
AlwI GGATC 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 23
BccI CCATC 1 cut(s) 34
BfaI CTAG 1 cut(s) 66
BmsI GCATC 2 cut(s) 26, 64
BsaBI GATNNNNATC 1 cut(s) 78
Bse3DI GCAATG 1 cut(s) 83
Bse8I GATNNNNATC 1 cut(s) 78
BseJI GATNNNNATC 1 cut(s) 78
BseMI GCAATG 1 cut(s) 83
BseRI GAGGAG 1 cut(s) 21
BsmI GAATGC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 79
BspPI GGATC 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 83
BssMI GATC 1 cut(s) 79
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
CviAII CATG 1 cut(s) 71
CviJI RGCY 3 cut(s) 61, 69, 120
CviKI_1 RGCY 3 cut(s) 61, 69, 120
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
FaeI CATG 1 cut(s) 74
FaiI YATR 3 cut(s) 72, 103, 108
FatI CATG 1 cut(s) 70
FspBI CTAG 1 cut(s) 66
Hin1II CATG 1 cut(s) 74
HindIII AAGCTT 1 cut(s) 59
HphI GGTGA 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 134
Hsp92II CATG 1 cut(s) 74
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 1 cut(s) 54
LweI GCATC 2 cut(s) 26, 64
MaeI CTAG 1 cut(s) 66
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MluCI AATT 1 cut(s) 126
MnlI CCTC 2 cut(s) 42, 130
MseI TTAA 1 cut(s) 5
Mva1269I GAATGC 1 cut(s) 44
NdeII GATC 1 cut(s) 79
NlaIII CATG 1 cut(s) 74
PctI GAATGC 1 cut(s) 44
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 1 cut(s) 79
SetI ASST 3 cut(s) 63, 122, 145
SfaNI GCATC 2 cut(s) 26, 64
SgeI CNNG 4 cut(s) 53, 78, 83, 133
Sse9I AATT 1 cut(s) 126
SspMI CTAG 1 cut(s) 66
TasI AATT 1 cut(s) 126
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.