Rroxscaffold_1G00073120

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
N/A
Physical Location & Seq
Forward (+)
94111812 .. 94113155
1344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00073120.1

Sequence Viewer

Length: 354 bp
ATGTTCCAATCGCTAGCGTTGTTTCTTCGTGGTAATGAGTTGAGATGGATTGGCAAAGAATTTTTTGACTTCATGCCTGTTTTGGTAGTGTTGGATTTGAGTGAAAACATTTCTCCACAAAGGCTGCCTTCGGAGTTTCGAAGCATGTTGCACTACAACGGCTCAATTTTTACTAAGGAAAGGCTACGGAAGCAATATGGTTGTGTCATCATCGGGTCGCGGTCGTCCTTGAGAGCTGCTTTTGCTCTATCAACCTCCAACATCTTAAGTCCGATATTTCAAATTTCAAGGGAAATTAACATCTTTCGCTTTCTCATCGCATACCTCCAAGACAAGATTTGTAATGCGGCATAG

Protein Analysis

117

Amino Acids

13.53

Weight (kDa)

9.69

Isoelectric Point (pI)

76.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 220
AciI CCGC 2 cut(s) 220, 347
AcsI RAATTY 2 cut(s) 59, 282
AflII CTTAAG 1 cut(s) 265
AgsI TTSAA 2 cut(s) 281, 288
AluBI AGCT 1 cut(s) 236
AluI AGCT 1 cut(s) 236
ApeKI GCWGC 2 cut(s) 124, 236
ApoI RAATTY 2 cut(s) 59, 282
AsuII TTCGAA 1 cut(s) 139
AsuNHI GCTAGC 1 cut(s) 13
BbvI GCAGC 2 cut(s) 111, 223
BccI CCATC 1 cut(s) 39
BceAI ACGGC 1 cut(s) 175
BfaI CTAG 1 cut(s) 14
BfrI CTTAAG 1 cut(s) 265
BisI GCNGC 3 cut(s) 125, 237, 348
BlsI GCNGC 3 cut(s) 126, 238, 349
BmtI GCTAGC 1 cut(s) 17
Bpu14I TTCGAA 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 250
BseXI GCAGC 2 cut(s) 111, 223
Bsh1236I CGCG 1 cut(s) 220
Bsh1285I CGRYCG 1 cut(s) 224
BsiEI CGRYCG 1 cut(s) 224
Bsp119I TTCGAA 1 cut(s) 139
BspACI CCGC 2 cut(s) 220, 347
BspFNI CGCG 1 cut(s) 220
BspOI GCTAGC 1 cut(s) 17
BspT104I TTCGAA 1 cut(s) 139
BspTI CTTAAG 1 cut(s) 265
BstAFI CTTAAG 1 cut(s) 265
BstBI TTCGAA 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 174
BstFNI CGCG 1 cut(s) 220
BstMCI CGRYCG 1 cut(s) 224
BstMWI GCNNNNNNNGC 2 cut(s) 190, 242
BstNSI RCATGY 1 cut(s) 148
BstUI CGCG 1 cut(s) 220
BstV1I GCAGC 2 cut(s) 111, 223
BtgZI GCGATG 1 cut(s) 301
Cac8I GCNNGC 1 cut(s) 15
CviAII CATG 2 cut(s) 73, 145
CviJI RGCY 4 cut(s) 124, 162, 184, 236
CviKI_1 RGCY 4 cut(s) 124, 162, 184, 236
DdeI CTNAG 1 cut(s) 174
FaeI CATG 2 cut(s) 76, 148
FaiI YATR 5 cut(s) 74, 146, 198, 322, 352
FalI AAGNNNNNCTT 2 cut(s) 112, 144
FatI CATG 2 cut(s) 72, 144
Fnu4HI GCNGC 3 cut(s) 125, 237, 348
Fsp4HI GCNGC 3 cut(s) 125, 237, 348
FspBI CTAG 1 cut(s) 14
GluI GCNGC 3 cut(s) 125, 237, 348
Hin1II CATG 2 cut(s) 76, 148
Hpy188I TCNGA 2 cut(s) 133, 273
HpyAV CCTTC 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 151
HpyF10VI GCNNNNNNNGC 2 cut(s) 190, 242
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 2 cut(s) 76, 148
LpnPI CCDG 1 cut(s) 90
Lsp1109I GCAGC 2 cut(s) 111, 223
MaeI CTAG 1 cut(s) 14
MboII GAAGA 1 cut(s) 17
MluCI AATT 4 cut(s) 59, 165, 282, 294
MmeI TCCRAC 2 cut(s) 72, 282
MnlI CCTC 2 cut(s) 265, 335
MseI TTAA 2 cut(s) 266, 297
MspCI CTTAAG 1 cut(s) 265
MvnI CGCG 1 cut(s) 220
MwoI GCNNNNNNNGC 2 cut(s) 190, 242
NheI GCTAGC 1 cut(s) 13
NlaIII CATG 2 cut(s) 76, 148
NspI RCATGY 1 cut(s) 148
NspV TTCGAA 1 cut(s) 139
PkrI GCNGC 3 cut(s) 126, 238, 349
SaqAI TTAA 2 cut(s) 266, 297
SatI GCNGC 3 cut(s) 125, 237, 348
SetI ASST 3 cut(s) 238, 257, 327
SfuI TTCGAA 1 cut(s) 139
SmlI CTYRAG 2 cut(s) 229, 265
SmoI CTYRAG 2 cut(s) 229, 265
Sse9I AATT 4 cut(s) 59, 165, 282, 294
SsiI CCGC 2 cut(s) 220, 347
SspMI CTAG 1 cut(s) 14
TaqI TCGA 1 cut(s) 139
TasI AATT 4 cut(s) 59, 165, 282, 294
TauI GCSGC 1 cut(s) 350
Tru1I TTAA 2 cut(s) 266, 297
Tru9I TTAA 2 cut(s) 266, 297
TseI GCWGC 2 cut(s) 124, 236
TspDTI ATGAA 1 cut(s) 61
TspGWI ACGGA 1 cut(s) 202
Vha464I CTTAAG 1 cut(s) 265
XapI RAATTY 2 cut(s) 59, 282
XceI RCATGY 1 cut(s) 148
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.