Rroxscaffold_2G00116540

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
N/A
Physical Location & Seq
Forward (+)
43786308 .. 43786832
525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00116540.1

Sequence Viewer

Length: 360 bp
ATGATAAAGCTGTTGAACTCTTTAGGCAGTAAGCTTTCAGAACAAACAAACCCTGAACCCACTCGAGAGTATGATGATCTGCATGTCAAGGAATATGTTGCATGTTTCCATAGAGGAAGAGTCAGAGACTATGTAACAAAAGTTGTGGACAATATATTGTGGCTTATTTCCTCATGGTGGGCTAAGATTCTAGTTGATAGAGCTTTCATAACCATCTCATCATGTCCTGACTGCAAACTCGAGATGCATGATTTACTACAAGAAATGCGTCAGCAAATAGGGAGATTCAGTAGGGAGTGGGGATGTGAAGGTGTTGATCGTGTATTTACTCAAAAGAAAGGTCCTAGACATTTGCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

14.05

Weight (kDa)

8.39

Isoelectric Point (pI)

35.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_ROQ1 PF23282 31 - 95 9.6e-06 Disease resistance protein Roq1-like, winged-helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 177
AgsI TTSAA 1 cut(s) 16
AluBI AGCT 3 cut(s) 10, 34, 203
AluI AGCT 3 cut(s) 10, 34, 203
Alw26I GTCTC 1 cut(s) 120
Ama87I CYCGRG 2 cut(s) 63, 239
ArsI GACNNNNNNTTYG 2 cut(s) 325, 357
AspS9I GGNCC 1 cut(s) 341
AvaI CYCGRG 2 cut(s) 63, 239
AvaII GGWCC 1 cut(s) 341
BccI CCATC 1 cut(s) 221
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 2 cut(s) 191, 345
Bme18I GGWCC 1 cut(s) 341
BmeT110I CYCGRG 2 cut(s) 63, 239
BmgT120I GGNCC 1 cut(s) 341
BmsI GCATC 1 cut(s) 234
BsaXI ACNNNNNCTCC 2 cut(s) 274, 304
Bsc4I CCNNNNNNNGG 1 cut(s) 177
BseGI GGATG 1 cut(s) 308
BseLI CCNNNNNNNGG 1 cut(s) 177
BsiHKCI CYCGRG 2 cut(s) 63, 239
BslI CCNNNNNNNGG 1 cut(s) 177
BsmAI GTCTC 1 cut(s) 120
BsoBI CYCGRG 2 cut(s) 63, 239
Bsp143I GATC 2 cut(s) 76, 316
BssMI GATC 2 cut(s) 76, 316
Bst6I CTCTTC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 183
BstF5I GGATG 1 cut(s) 308
BstKTI GATC 2 cut(s) 79, 319
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 2 cut(s) 76, 316
BstNSI RCATGY 2 cut(s) 86, 105
BtsCI GGATG 1 cut(s) 308
Cfr13I GGNCC 1 cut(s) 341
CseI GACGC 1 cut(s) 257
CspCI CAANNNNNGTGG 2 cut(s) 126, 161
CviAII CATG 5 cut(s) 83, 102, 174, 222, 248
CviJI RGCY 5 cut(s) 10, 34, 163, 182, 203
CviKI_1 RGCY 5 cut(s) 10, 34, 163, 182, 203
DdeI CTNAG 1 cut(s) 183
DpnI GATC 2 cut(s) 78, 318
DpnII GATC 2 cut(s) 76, 316
Eam1104I CTCTTC 1 cut(s) 112
EarI CTCTTC 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 341
Eco88I CYCGRG 2 cut(s) 63, 239
EcoO109I RGGNCCY 1 cut(s) 341
EcoT22I ATGCAT 1 cut(s) 249
FaeI CATG 5 cut(s) 86, 105, 177, 225, 251
FatI CATG 5 cut(s) 82, 101, 173, 221, 247
FokI GGATG 1 cut(s) 315
FspBI CTAG 2 cut(s) 191, 345
HgaI GACGC 1 cut(s) 257
Hin1II CATG 5 cut(s) 86, 105, 177, 225, 251
HindIII AAGCTT 1 cut(s) 32
HinfI GANTC 3 cut(s) 120, 187, 285
Hpy166II GTNNAC 1 cut(s) 148
Hpy188I TCNGA 2 cut(s) 40, 125
Hpy188III TCNNGA 3 cut(s) 65, 227, 241
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 302
HpyCH4V TGCA 5 cut(s) 82, 101, 234, 247, 355
HpyF3I CTNAG 1 cut(s) 183
Hsp92II CATG 5 cut(s) 86, 105, 177, 225, 251
Kzo9I GATC 2 cut(s) 76, 316
LpnPI CCDG 2 cut(s) 66, 240
LweI GCATC 1 cut(s) 234
MaeI CTAG 2 cut(s) 191, 345
MaeIII GTNAC 1 cut(s) 133
MalI GATC 2 cut(s) 78, 318
MboI GATC 2 cut(s) 76, 316
MboII GAAGA 1 cut(s) 129
MlyI GAGTC 1 cut(s) 129
MnlI CCTC 2 cut(s) 107, 181
Mph1103I ATGCAT 1 cut(s) 249
NdeII GATC 2 cut(s) 76, 316
NlaIII CATG 5 cut(s) 86, 105, 177, 225, 251
NsiI ATGCAT 1 cut(s) 249
NspI RCATGY 2 cut(s) 86, 105
PaeR7I CTCGAG 2 cut(s) 63, 239
PfeI GAWTC 2 cut(s) 187, 285
PleI GAGTC 1 cut(s) 128
PpsI GAGTC 1 cut(s) 128
PpuMI RGGWCCY 1 cut(s) 341
Psp5II RGGWCCY 1 cut(s) 341
PspPI GGNCC 1 cut(s) 341
PspPPI RGGWCCY 1 cut(s) 341
Sau3AI GATC 2 cut(s) 76, 316
Sau96I GGNCC 1 cut(s) 341
SchI GAGTC 1 cut(s) 129
SetI ASST 5 cut(s) 12, 36, 205, 313, 343
SfaNI GCATC 1 cut(s) 234
Sfr274I CTCGAG 2 cut(s) 63, 239
SinI GGWCC 1 cut(s) 341
SlaI CTCGAG 2 cut(s) 63, 239
SmlI CTYRAG 2 cut(s) 63, 239
SmoI CTYRAG 2 cut(s) 63, 239
SspMI CTAG 2 cut(s) 191, 345
TaqI TCGA 2 cut(s) 64, 240
TfiI GAWTC 2 cut(s) 187, 285
TspDTI ATGAA 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 341
XceI RCATGY 2 cut(s) 86, 105
XhoI CTCGAG 2 cut(s) 63, 239
XspI CTAG 2 cut(s) 191, 345
Zsp2I ATGCAT 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.