Rroxscaffold_2G00126950

Disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
N/A
Physical Location & Seq
Reverse (-)
62382548 .. 62382943
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00126950.1

Sequence Viewer

Length: 168 bp
ATGTTGTCCAACAAATCGCAGAAATTGTTTGCAGCAAACCTTTTGAAATTGTTATCAACAGAAGATATTGAAACTCATGGAATTTCTCCTCGTTGGAAGTATGATGTGTTTATAAATTTCAGGGGTGAGGACACTTGTAAGGGTTTTCTCGTCCGATTTGCTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.34

Weight (kDa)

8.98

Isoelectric Point (pI)

39.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 113
AcsI RAATTY 2 cut(s) 81, 115
AgsI TTSAA 2 cut(s) 46, 71
AluBI AGCT 1 cut(s) 165
AluI AGCT 1 cut(s) 165
ApeKI GCWGC 1 cut(s) 32
ApoI RAATTY 2 cut(s) 81, 115
AsuHPI GGTGA 1 cut(s) 137
AsuNHI GCTAGC 1 cut(s) 161
BbvI GCAGC 1 cut(s) 44
BfaI CTAG 1 cut(s) 162
BisI GCNGC 1 cut(s) 33
BlsI GCNGC 1 cut(s) 34
BmtI GCTAGC 1 cut(s) 165
BseRI GAGGAG 1 cut(s) 78
BseXI GCAGC 1 cut(s) 44
BspOI GCTAGC 1 cut(s) 165
BstC8I GCNNGC 1 cut(s) 163
BstV1I GCAGC 1 cut(s) 44
Cac8I GCNNGC 1 cut(s) 163
CviAII CATG 1 cut(s) 77
CviJI RGCY 1 cut(s) 165
CviKI_1 RGCY 1 cut(s) 165
FaeI CATG 1 cut(s) 80
FaiI YATR 3 cut(s) 78, 102, 113
FatI CATG 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 33
Fsp4HI GCNGC 1 cut(s) 33
FspBI CTAG 1 cut(s) 162
GluI GCNGC 1 cut(s) 33
Hin1II CATG 1 cut(s) 80
HphI GGTGA 1 cut(s) 137
Hpy188I TCNGA 1 cut(s) 155
HpyCH4V TGCA 1 cut(s) 32
Hsp92II CATG 1 cut(s) 80
LpnPI CCDG 1 cut(s) 106
Lsp1109I GCAGC 1 cut(s) 44
MaeI CTAG 1 cut(s) 162
MboII GAAGA 1 cut(s) 74
MluCI AATT 4 cut(s) 23, 47, 81, 115
MmeI TCCRAC 2 cut(s) 33, 74
MnlI CCTC 2 cut(s) 99, 121
NheI GCTAGC 1 cut(s) 161
NlaIII CATG 1 cut(s) 80
PkrI GCNGC 1 cut(s) 34
PsiI TTATAA 1 cut(s) 113
SatI GCNGC 1 cut(s) 33
SetI ASST 2 cut(s) 42, 167
SgeI CNNG 5 cut(s) 89, 102, 133, 147, 161
Sse9I AATT 4 cut(s) 23, 47, 81, 115
SspMI CTAG 1 cut(s) 162
TasI AATT 4 cut(s) 23, 47, 81, 115
TseI GCWGC 1 cut(s) 32
XapI RAATTY 2 cut(s) 81, 115
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.