Rroxscaffold_2G00127130

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
N/A
Physical Location & Seq
Reverse (-)
62576560 .. 62578825
2266 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00127130.1

Sequence Viewer

Length: 150 bp
ATGGAGAACTTGGTTGGGATAGATTCAAGAGTAGAAGCAGTTAATTTGCTTTCAGGTGTTGGGGTGAATGATGCTCACTTTATAGGGATAACGGGAATGGGTGGAATTGGTAAGACAACTATTACCAAAGTTGTCACGCCCCGAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.05

Weight (kDa)

6.52

Isoelectric Point (pI)

-0.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 144
AgsI TTSAA 1 cut(s) 27
ApoI RAATTY 1 cut(s) 144
AsuHPI GGTGA 1 cut(s) 76
BmsI GCATC 1 cut(s) 61
FaiI YATR 1 cut(s) 83
HinfI GANTC 1 cut(s) 23
HphI GGTGA 1 cut(s) 76
Hpy188III TCNNGA 1 cut(s) 27
LpnPI CCDG 1 cut(s) 39
LweI GCATC 1 cut(s) 61
MaeIII GTNAC 1 cut(s) 133
MluCI AATT 3 cut(s) 43, 105, 144
MseI TTAA 1 cut(s) 42
NmuCI GTSAC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 23
SaqAI TTAA 1 cut(s) 42
SetI ASST 1 cut(s) 58
SfaNI GCATC 1 cut(s) 61
SgeI CNNG 4 cut(s) 22, 39, 66, 105
Sse9I AATT 3 cut(s) 43, 105, 144
TasI AATT 3 cut(s) 43, 105, 144
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TseFI GTSAC 1 cut(s) 133
Tsp45I GTSAC 1 cut(s) 133
XapI RAATTY 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.