Rroxscaffold_2G00140370

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
N/A
Physical Location & Seq
Forward (+)
78607001 .. 78609352
2352 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00140370.1

Sequence Viewer

Length: 726 bp
ATGATCTTGGAAAAGGGTACTCAAATGGCTCACTCTATCTCAGCTATAAGAAAAGATTCTGTCAGTTCAGTCAATAAAGGAGGCAGTGACTCAGTGAGGACTAGTATATTATCGAGCAAGTGGAGGTACAAATGGACTATGCTTCCAGATCTTGTGTTTGATGAACAGGGTTTCCCAGGACTTACGATTGATGCGCCAAATCTCCGAATCTTTACCTTAAAGGTGCTTTTGAGGATTCAGAACACCTTAAAGATTAAATGTACGTATTGGCATTTCTTTGAAAGCTATGGTGATCTAAGACAGTTTCCTGGCCGTTCTAGCAATTTGCTCAATCTTTTTGCTCAGTGTGCGCATGTTCAATGTTATTTGGCTGTTGGTGACTTGCCGTTAAAGCTTCCTAAATCATGTCTGCATCTGATGGATCTTCTTCTTATAGACATAAATTTCAATAATCTGAAGGAGATTTTAACTACATTATACCTCCAGAGAAGCTCCCCTGCTCTACAAAGATTATGTATCACGAAAACTGCTAATTGTGGAAGTAGAGGCCTCACTAGCACCAAAGCTGGACTAGATTTCATCAAATTTCTGCTTTTAAATTCACCTATGCTTGAGAAGGTGTTTGTTTTGCCTGCGTCTTACGATAGTTCTTCGGAACTCTTGAAAAGGTTGATCCAGTTTGGGCGTTCCTCAGCACATGCGGATATAATCTACTTGAACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

241

Amino Acids

27.19

Weight (kDa)

9.47

Isoelectric Point (pI)

44.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 351
AciI CCGC 1 cut(s) 701
AclWI GGATC 2 cut(s) 429, 667
AcoI YGGCCR 1 cut(s) 310
AcsI RAATTY 3 cut(s) 442, 584, 598
AcuI CTGAAG 1 cut(s) 476
AfaI GTAC 3 cut(s) 19, 128, 262
AgsI TTSAA 5 cut(s) 281, 359, 448, 664, 718
AhlI ACTAGT 1 cut(s) 101
AjnI CCWGG 2 cut(s) 175, 307
AloI GAACNNNNNNTCC 2 cut(s) 156, 188
AluBI AGCT 5 cut(s) 44, 285, 394, 492, 566
AluI AGCT 5 cut(s) 44, 285, 394, 492, 566
AlwI GGATC 2 cut(s) 429, 667
AoxI GGCC 2 cut(s) 310, 547
ApoI RAATTY 3 cut(s) 442, 584, 598
Asp700I GAANNNNTTC 1 cut(s) 55
AspLEI GCGC 2 cut(s) 196, 352
AsuHPI GGTGA 3 cut(s) 302, 389, 594
BbvCI CCTCAGC 1 cut(s) 691
BccI CCATC 1 cut(s) 412
BceAI ACGGC 2 cut(s) 297, 370
BciT130I CCWGG 2 cut(s) 177, 309
BcuI ACTAGT 1 cut(s) 101
BfaI CTAG 4 cut(s) 102, 318, 555, 572
BglII AGATCT 1 cut(s) 148
Bme1390I CCNGG 2 cut(s) 177, 309
BmrFI CCNGG 2 cut(s) 177, 309
BmsI GCATC 2 cut(s) 181, 421
BpmI CTGGAG 1 cut(s) 467
Bpu10I CCTNAGC 1 cut(s) 691
BpuEI CTTGAG 1 cut(s) 632
BsaAI YACGTR 1 cut(s) 264
BsaJI CCNNGG 1 cut(s) 175
Bse1I ACTGG 1 cut(s) 676
BseBI CCWGG 2 cut(s) 177, 309
BseDI CCNNGG 1 cut(s) 175
BseMII CTCAG 4 cut(s) 54, 105, 356, 705
BseNI ACTGG 1 cut(s) 676
BshFI GGCC 2 cut(s) 312, 549
BsnI GGCC 2 cut(s) 312, 549
Bsp143I GATC 5 cut(s) 3, 148, 292, 421, 672
BspACI CCGC 1 cut(s) 701
BspANI GGCC 2 cut(s) 312, 549
BspCNI CTCAG 4 cut(s) 53, 104, 355, 704
BspPI GGATC 2 cut(s) 429, 667
BsrI ACTGG 1 cut(s) 676
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 5 cut(s) 3, 148, 292, 421, 672
Bst2UI CCWGG 2 cut(s) 177, 309
Bst4CI ACNGT 1 cut(s) 303
BstBAI YACGTR 1 cut(s) 264
BstC8I GCNNGC 1 cut(s) 633
BstDEI CTNAG 5 cut(s) 40, 91, 296, 342, 691
BstHHI GCGC 2 cut(s) 196, 352
BstKTI GATC 5 cut(s) 6, 151, 295, 424, 675
BstMBI GATC 5 cut(s) 3, 148, 292, 421, 672
BstMWI GCNNNNNNNGC 4 cut(s) 318, 347, 391, 555
BstNI CCWGG 2 cut(s) 177, 309
BstNSI RCATGY 2 cut(s) 356, 701
BstSCI CCNGG 2 cut(s) 175, 307
BstSNI TACGTA 1 cut(s) 264
BstX2I RGATCY 2 cut(s) 148, 421
BstYI RGATCY 2 cut(s) 148, 421
BsuRI GGCC 2 cut(s) 312, 549
BtsI GCAGTG 1 cut(s) 91
BtsIMutI CAGTG 3 cut(s) 91, 99, 350
Cac8I GCNNGC 1 cut(s) 633
CfoI GCGC 2 cut(s) 196, 352
CseI GACGC 1 cut(s) 624
Csp6I GTAC 3 cut(s) 18, 127, 261
CviAII CATG 3 cut(s) 353, 405, 698
CviJI RGCY 9 cut(s) 29, 44, 285, 312, 371, 394, 492, 549, 566
CviKI_1 RGCY 9 cut(s) 29, 44, 285, 312, 371, 394, 492, 549, 566
CviQI GTAC 3 cut(s) 18, 127, 261
DdeI CTNAG 5 cut(s) 40, 91, 296, 342, 691
DpnI GATC 5 cut(s) 5, 150, 294, 423, 674
DpnII GATC 5 cut(s) 3, 148, 292, 421, 672
DraI TTTAAA 1 cut(s) 597
EaeI YGGCCR 1 cut(s) 310
Eco105I TACGTA 1 cut(s) 264
Eco147I AGGCCT 1 cut(s) 549
Eco57I CTGAAG 1 cut(s) 476
EcoRII CCWGG 2 cut(s) 175, 307
FaeI CATG 3 cut(s) 356, 408, 701
FatI CATG 3 cut(s) 352, 404, 697
FspAI RTGCGCAY 1 cut(s) 351
FspBI CTAG 4 cut(s) 102, 318, 555, 572
FspI TGCGCA 1 cut(s) 351
GlaI GCGC 2 cut(s) 195, 351
GsuI CTGGAG 1 cut(s) 467
HaeIII GGCC 2 cut(s) 312, 549
HgaI GACGC 1 cut(s) 624
HhaI GCGC 2 cut(s) 196, 352
Hin1II CATG 3 cut(s) 356, 408, 701
Hin6I GCGC 2 cut(s) 194, 350
HinP1I GCGC 2 cut(s) 194, 350
HindIII AAGCTT 1 cut(s) 392
HinfI GANTC 4 cut(s) 56, 89, 207, 235
HphI GGTGA 3 cut(s) 302, 389, 594
Hpy188I TCNGA 5 cut(s) 206, 240, 417, 456, 655
Hpy188III TCNNGA 4 cut(s) 146, 484, 520, 661
HpyAV CCTTC 2 cut(s) 451, 610
HpyCH4III ACNGT 1 cut(s) 303
HpyCH4IV ACGT 1 cut(s) 263
HpyCH4V TGCA 1 cut(s) 412
HpyF10VI GCNNNNNNNGC 4 cut(s) 318, 347, 391, 555
HpyF3I CTNAG 5 cut(s) 40, 91, 296, 342, 691
HpySE526I ACGT 1 cut(s) 263
Hsp92II CATG 3 cut(s) 356, 408, 701
HspAI GCGC 2 cut(s) 194, 350
Kzo9I GATC 5 cut(s) 3, 148, 292, 421, 672
LmnI GCTCC 1 cut(s) 497
LweI GCATC 2 cut(s) 181, 421
MaeI CTAG 4 cut(s) 102, 318, 555, 572
MaeII ACGT 1 cut(s) 263
MaeIII GTNAC 2 cut(s) 86, 377
MalI GATC 5 cut(s) 5, 150, 294, 423, 674
MboI GATC 5 cut(s) 3, 148, 292, 421, 672
MboII GAAGA 3 cut(s) 416, 419, 642
MflI RGATCY 2 cut(s) 148, 421
MluCI AATT 5 cut(s) 322, 442, 532, 584, 598
MlyI GAGTC 1 cut(s) 83
MnlI CCTC 8 cut(s) 74, 90, 117, 225, 491, 539, 560, 700
MroXI GAANNNNTTC 1 cut(s) 55
MseI TTAA 6 cut(s) 218, 248, 255, 389, 467, 596
MspR9I CCNGG 2 cut(s) 177, 309
MvaI CCWGG 2 cut(s) 177, 309
MwoI GCNNNNNNNGC 4 cut(s) 318, 347, 391, 555
NdeII GATC 5 cut(s) 3, 148, 292, 421, 672
NlaIII CATG 3 cut(s) 356, 408, 701
NmuCI GTSAC 2 cut(s) 86, 377
NsbI TGCGCA 1 cut(s) 351
NspI RCATGY 2 cut(s) 356, 701
PceI AGGCCT 1 cut(s) 549
PdmI GAANNNNTTC 1 cut(s) 55
PfeI GAWTC 3 cut(s) 56, 207, 235
PleI GAGTC 1 cut(s) 83
PpsI GAGTC 1 cut(s) 83
Ppu21I YACGTR 1 cut(s) 264
Psp6I CCWGG 2 cut(s) 175, 307
PspGI CCWGG 2 cut(s) 175, 307
PsuI RGATCY 2 cut(s) 148, 421
RsaI GTAC 3 cut(s) 19, 128, 262
RsaNI GTAC 3 cut(s) 18, 127, 261
SaqAI TTAA 6 cut(s) 218, 248, 255, 389, 467, 596
Sau3AI GATC 5 cut(s) 3, 148, 292, 421, 672
SchI GAGTC 1 cut(s) 83
ScrFI CCNGG 2 cut(s) 177, 309
SfaNI GCATC 2 cut(s) 181, 421
SmlI CTYRAG 1 cut(s) 611
SmoI CTYRAG 1 cut(s) 611
SnaBI TACGTA 1 cut(s) 264
SpeI ACTAGT 1 cut(s) 101
Sse9I AATT 5 cut(s) 322, 442, 532, 584, 598
SseBI AGGCCT 1 cut(s) 549
SsiI CCGC 1 cut(s) 701
SspMI CTAG 4 cut(s) 102, 318, 555, 572
StuI AGGCCT 1 cut(s) 549
StyD4I CCNGG 2 cut(s) 175, 307
TaaI ACNGT 1 cut(s) 303
TaiI ACGT 1 cut(s) 266
TaqI TCGA 1 cut(s) 113
TasI AATT 5 cut(s) 322, 442, 532, 584, 598
TfiI GAWTC 3 cut(s) 56, 207, 235
Tru1I TTAA 6 cut(s) 218, 248, 255, 389, 467, 596
Tru9I TTAA 6 cut(s) 218, 248, 255, 389, 467, 596
TscAI CASTG 3 cut(s) 91, 99, 350
TseFI GTSAC 2 cut(s) 86, 377
Tsp45I GTSAC 2 cut(s) 86, 377
TspDTI ATGAA 2 cut(s) 177, 568
TspRI CASTG 3 cut(s) 91, 99, 350
XapI RAATTY 3 cut(s) 442, 584, 598
XceI RCATGY 2 cut(s) 356, 701
XmnI GAANNNNTTC 1 cut(s) 55
XspI CTAG 4 cut(s) 102, 318, 555, 572
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.