Rroxscaffold_2G00152490

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
N/A
Physical Location & Seq
Reverse (-)
89436214 .. 89443621
7408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00152490.1

Sequence Viewer

Length: 243 bp
ATGGAGGAATGGTCCAGTGGGGGATTGTCCACTGTGGCTCCATTACAAGAACCACATGTTTACAGCTTCGGAGTTTTACTGCTGGAGATTGTGAGTAGCAAAAAGAACAATGTCTTTGCTTCATCTACATCTCTCACCCTTATTGAGCACCATTTGAAATCGCTCCCCTTTGTAGTGCTCTCCACGGCTTCGGTTGTCGCTATTCCTCTAGTGATTGCTTATCAATCTCTTTTGAGGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

80

Amino Acids

8.62

Weight (kDa)

6.24

Isoelectric Point (pI)

48.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 55
AgsI TTSAA 1 cut(s) 157
AluBI AGCT 1 cut(s) 66
AluI AGCT 1 cut(s) 66
Alw21I GWGCWC 2 cut(s) 150, 180
AspS9I GGNCC 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 127
AvaII GGWCC 1 cut(s) 12
Bbv12I GWGCWC 2 cut(s) 150, 180
BceAI ACGGC 1 cut(s) 201
BfaI CTAG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 12
BmiI GGNNCC 1 cut(s) 39
BpmI CTGGAG 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 183
BsaXI ACNNNNNCTCC 3 cut(s) 22, 26, 52
Bse1I ACTGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 183
BseNI ACTGG 1 cut(s) 15
BsiHKAI GWGCWC 2 cut(s) 150, 180
Bsp1286I GDGCHC 2 cut(s) 150, 180
BspLI GGNNCC 1 cut(s) 39
BsrI ACTGG 1 cut(s) 15
BssECI CCNNGG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 34
BstDSI CCRYGG 1 cut(s) 183
BstNSI RCATGY 1 cut(s) 59
BtgI CCRYGG 1 cut(s) 183
BtsIMutI CAGTG 2 cut(s) 22, 30
Cfr13I GGNCC 1 cut(s) 12
CviAII CATG 1 cut(s) 56
CviJI RGCY 4 cut(s) 38, 66, 188, 239
CviKI_1 RGCY 4 cut(s) 38, 66, 188, 239
Eco47I GGWCC 1 cut(s) 12
FaeI CATG 1 cut(s) 59
FaiI YATR 1 cut(s) 57
FatI CATG 1 cut(s) 55
FspBI CTAG 1 cut(s) 209
GsuI CTGGAG 1 cut(s) 104
Hin1II CATG 1 cut(s) 59
HphI GGTGA 1 cut(s) 127
Hpy166II GTNNAC 2 cut(s) 30, 61
Hpy188I TCNGA 1 cut(s) 71
Hpy8I GTNNAC 2 cut(s) 30, 61
HpyCH4III ACNGT 1 cut(s) 34
Hsp92II CATG 1 cut(s) 59
LmnI GCTCC 2 cut(s) 43, 168
LpnPI CCDG 2 cut(s) 28, 68
MaeI CTAG 1 cut(s) 209
MhlI GDGCHC 2 cut(s) 150, 180
MnlI CCTC 2 cut(s) 216, 228
MseI TTAA 1 cut(s) 241
NlaIII CATG 1 cut(s) 59
NlaIV GGNNCC 1 cut(s) 39
NspI RCATGY 1 cut(s) 59
PciI ACATGT 1 cut(s) 55
PscI ACATGT 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 39
PspPI GGNCC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 12
SduI GDGCHC 2 cut(s) 150, 180
SetI ASST 1 cut(s) 68
SgeI CNNG 6 cut(s) 27, 59, 68, 95, 196, 221
SinI GGWCC 1 cut(s) 12
SspMI CTAG 1 cut(s) 209
TaaI ACNGT 1 cut(s) 34
Tru1I TTAA 1 cut(s) 241
Tru9I TTAA 1 cut(s) 241
TscAI CASTG 2 cut(s) 22, 37
TspDTI ATGAA 1 cut(s) 111
TspRI CASTG 2 cut(s) 22, 37
VpaK11BI GGWCC 1 cut(s) 12
XceI RCATGY 1 cut(s) 59
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.