Rroxscaffold_3G00219470

Cyclic nucleotide-monophosphate binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
N/A
Physical Location & Seq
Reverse (-)
1576729 .. 1577443
715 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00219470.1

Sequence Viewer

Length: 303 bp
ATGGCTAGCCCGGAAGTAACTGTAGCCGTGGACGACTCAAACGATATGGCTAACAGTGTAACCGTAAACGAGTCGGAAGAGAAAGCGAACAGAACTTCAGTTGTGGAGAATTCTGGAGAGCAAGTTGAAAGATCTGAGAGCTGTTCAGGTCTAATCAGTAGATTCCGTAACACACACCGGTCCAGGGCAAAGTTGTTATGGAACACTTTTTTACCAGCAATAGCTAAGACGATCCGGCAGTCATACATCTTAATCTTAATCGACATTTTAGCTATTCTTCCCCTTCCTCAGGTACGAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

100

Amino Acids

11.14

Weight (kDa)

5.41

Isoelectric Point (pI)

70.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 226
AcsI RAATTY 1 cut(s) 109
AcuI CTGAAG 1 cut(s) 81
AfaI GTAC 1 cut(s) 294
AfiI CCNNNNNNNGG 2 cut(s) 184, 289
AgeI ACCGGT 1 cut(s) 177
AgsI TTSAA 1 cut(s) 128
AjnI CCWGG 1 cut(s) 182
AluBI AGCT 3 cut(s) 141, 224, 272
AluI AGCT 3 cut(s) 141, 224, 272
AlwI GGATC 1 cut(s) 226
ApoI RAATTY 1 cut(s) 109
AsiGI ACCGGT 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 180
AsuC2I CCSGG 1 cut(s) 11
AsuNHI GCTAGC 1 cut(s) 5
AvaII GGWCC 1 cut(s) 180
AxyI CCTNAGG 1 cut(s) 288
BaeI ACNNNNGTAYC 1 cut(s) 284
BceAI ACGGC 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 184
BcnI CCSGG 1 cut(s) 11
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 21
BglII AGATCT 1 cut(s) 131
Bme1390I CCNGG 2 cut(s) 11, 184
Bme18I GGWCC 1 cut(s) 180
BmgT120I GGNCC 1 cut(s) 180
BmrFI CCNGG 2 cut(s) 11, 184
BmtI GCTAGC 1 cut(s) 9
BpmI CTGGAG 1 cut(s) 135
BpuMI CCSGG 1 cut(s) 11
BsaJI CCNNGG 2 cut(s) 27, 183
BsaWI WCCGGW 1 cut(s) 177
BsaXI ACNNNNNCTCC 2 cut(s) 108, 138
Bsc4I CCNNNNNNNGG 2 cut(s) 184, 289
Bse118I RCCGGY 1 cut(s) 177
Bse21I CCTNAGG 1 cut(s) 288
BseBI CCWGG 1 cut(s) 184
BseDI CCNNGG 2 cut(s) 27, 183
BseLI CCNNNNNNNGG 2 cut(s) 184, 289
BseMII CTCAG 2 cut(s) 126, 302
BshTI ACCGGT 1 cut(s) 177
BsiSI CCGG 3 cut(s) 11, 178, 235
BslI CCNNNNNNNGG 2 cut(s) 184, 289
Bsp143I GATC 2 cut(s) 131, 231
BspCNI CTCAG 2 cut(s) 127, 301
BspOI GCTAGC 1 cut(s) 9
BspPI GGATC 1 cut(s) 226
BsrFI RCCGGY 1 cut(s) 177
BssAI RCCGGY 1 cut(s) 177
BssECI CCNNGG 2 cut(s) 27, 183
BssMI GATC 2 cut(s) 131, 231
Bst2UI CCWGG 1 cut(s) 184
Bst4CI ACNGT 3 cut(s) 22, 56, 64
Bst6I CTCTTC 1 cut(s) 72
BstC8I GCNNGC 1 cut(s) 7
BstDEI CTNAG 3 cut(s) 135, 225, 288
BstDSI CCRYGG 1 cut(s) 27
BstENI CCTNNNNNAGG 1 cut(s) 287
BstKTI GATC 2 cut(s) 134, 234
BstMBI GATC 2 cut(s) 131, 231
BstNI CCWGG 1 cut(s) 184
BstSCI CCNGG 2 cut(s) 9, 182
BstSFI CTRYAG 1 cut(s) 21
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
Bsu36I CCTNAGG 1 cut(s) 288
BtgI CCRYGG 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 7
Cfr10I RCCGGY 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 180
Csp6I GTAC 1 cut(s) 293
CspAI ACCGGT 1 cut(s) 177
CviJI RGCY 7 cut(s) 5, 9, 26, 50, 141, 224, 272
CviKI_1 RGCY 7 cut(s) 5, 9, 26, 50, 141, 224, 272
CviQI GTAC 1 cut(s) 293
DdeI CTNAG 3 cut(s) 135, 225, 288
DpnI GATC 2 cut(s) 133, 233
DpnII GATC 2 cut(s) 131, 231
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 180
Eco57I CTGAAG 1 cut(s) 81
Eco81I CCTNAGG 1 cut(s) 288
EcoNI CCTNNNNNAGG 1 cut(s) 287
EcoRI GAATTC 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 182
FaiI YATR 3 cut(s) 47, 199, 244
FspBI CTAG 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 135
HapII CCGG 3 cut(s) 11, 178, 235
HinfI GANTC 3 cut(s) 35, 71, 162
HpaII CCGG 3 cut(s) 11, 178, 235
Hpy166II GTNNAC 2 cut(s) 31, 67
Hpy188I TCNGA 2 cut(s) 76, 136
Hpy188III TCNNGA 1 cut(s) 114
Hpy8I GTNNAC 2 cut(s) 31, 67
HpyAV CCTTC 1 cut(s) 293
HpyCH4III ACNGT 3 cut(s) 22, 56, 64
HpyF3I CTNAG 3 cut(s) 135, 225, 288
Kzo9I GATC 2 cut(s) 131, 231
LpnPI CCDG 9 cut(s) 24, 99, 132, 169, 191, 196, 228, 248, 275
MaeI CTAG 1 cut(s) 6
MaeIII GTNAC 3 cut(s) 16, 58, 167
MalI GATC 2 cut(s) 133, 233
MboI GATC 2 cut(s) 131, 231
MboII GAAGA 2 cut(s) 89, 269
MflI RGATCY 1 cut(s) 131
MluCI AATT 1 cut(s) 109
MlyI GAGTC 2 cut(s) 29, 80
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 1 cut(s) 297
MseI TTAA 2 cut(s) 251, 257
MspI CCGG 3 cut(s) 11, 178, 235
MspR9I CCNGG 2 cut(s) 11, 184
MvaI CCWGG 1 cut(s) 184
NciI CCSGG 1 cut(s) 11
NdeII GATC 2 cut(s) 131, 231
NheI GCTAGC 1 cut(s) 5
PcsI WCGNNNNNNNCGW 1 cut(s) 39
PfeI GAWTC 1 cut(s) 162
PinAI ACCGGT 1 cut(s) 177
PleI GAGTC 2 cut(s) 29, 79
PpsI GAGTC 2 cut(s) 29, 79
Psp6I CCWGG 1 cut(s) 182
PspGI CCWGG 1 cut(s) 182
PspPI GGNCC 1 cut(s) 180
PsuI RGATCY 1 cut(s) 131
RsaI GTAC 1 cut(s) 294
RsaNI GTAC 1 cut(s) 293
SaqAI TTAA 2 cut(s) 251, 257
Sau3AI GATC 2 cut(s) 131, 231
Sau96I GGNCC 1 cut(s) 180
SchI GAGTC 2 cut(s) 29, 80
ScrFI CCNGG 2 cut(s) 11, 184
SetI ASST 5 cut(s) 143, 151, 226, 274, 294
SfcI CTRYAG 1 cut(s) 21
SinI GGWCC 1 cut(s) 180
Sse9I AATT 1 cut(s) 109
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 2 cut(s) 9, 182
TaaI ACNGT 3 cut(s) 22, 56, 64
TaqI TCGA 1 cut(s) 261
TasI AATT 1 cut(s) 109
TfiI GAWTC 1 cut(s) 162
Tru1I TTAA 2 cut(s) 251, 257
Tru9I TTAA 2 cut(s) 251, 257
TscAI CASTG 1 cut(s) 61
TspGWI ACGGA 1 cut(s) 155
TspRI CASTG 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 180
XagI CCTNNNNNAGG 1 cut(s) 287
XapI RAATTY 1 cut(s) 109
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.