Rroxscaffold_3G00234860
BZIP Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
N/A
Physical Location & Seq
Reverse (-)
21553850 .. 21554306
457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00234860.1

Sequence Viewer

Length: 183 bp
ATGCGGTTCATTGCTGAGCTTAATAAAAAAGTTCAGAATTTGCAAACAGAAGCAGCTCACTTGTCTGCTCAGTTTACTCTATTGCAGCTAGGTACATTTTATCAGCTCCAACACCTAACGCAATCTTGTTTAAGAGATGATATTACTGGATGGTCCATTCATTCAATTGGTAGCTTGCGGTAA

Protein Analysis

60

Amino Acids

6.87

Weight (kDa)

8.0

Isoelectric Point (pI)

57.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 4, 178
AcsI RAATTY 1 cut(s) 37
AfaI GTAC 1 cut(s) 94
AgsI TTSAA 1 cut(s) 165
AluBI AGCT 5 cut(s) 19, 56, 88, 106, 174
AluI AGCT 5 cut(s) 19, 56, 88, 106, 174
ApeKI GCWGC 2 cut(s) 53, 85
ApoI RAATTY 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 153
AvaII GGWCC 1 cut(s) 153
BbvI GCAGC 2 cut(s) 65, 97
BccI CCATC 1 cut(s) 144
BfaI CTAG 1 cut(s) 89
BisI GCNGC 2 cut(s) 54, 86
BlpI GCTNAGC 1 cut(s) 15
BlsI GCNGC 2 cut(s) 55, 87
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
Bpu1102I GCTNAGC 1 cut(s) 15
Bse1I ACTGG 1 cut(s) 151
Bse3DI GCAATG 1 cut(s) 9
BseGI GGATG 1 cut(s) 155
BseMI GCAATG 1 cut(s) 9
BseMII CTCAG 2 cut(s) 6, 83
BseNI ACTGG 1 cut(s) 151
BseXI GCAGC 2 cut(s) 65, 97
Bsp1720I GCTNAGC 1 cut(s) 15
BspACI CCGC 2 cut(s) 4, 178
BspCNI CTCAG 2 cut(s) 7, 82
BsrDI GCAATG 1 cut(s) 9
BsrI ACTGG 1 cut(s) 151
BstC8I GCNNGC 1 cut(s) 176
BstDEI CTNAG 2 cut(s) 15, 69
BstF5I GGATG 1 cut(s) 155
BstV1I GCAGC 2 cut(s) 65, 97
BtsCI GGATG 1 cut(s) 155
Cac8I GCNNGC 1 cut(s) 176
Cfr13I GGNCC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 93
CviJI RGCY 5 cut(s) 19, 56, 88, 106, 174
CviKI_1 RGCY 5 cut(s) 19, 56, 88, 106, 174
CviQI GTAC 1 cut(s) 93
DdeI CTNAG 2 cut(s) 15, 69
Eco47I GGWCC 1 cut(s) 153
Fnu4HI GCNGC 2 cut(s) 54, 86
FokI GGATG 1 cut(s) 162
Fsp4HI GCNGC 2 cut(s) 54, 86
FspBI CTAG 1 cut(s) 89
FspEI CC 8 cut(s) 75, 122, 128, 132, 136, 153, 163, 169
GluI GCNGC 2 cut(s) 54, 86
Hpy166II GTNNAC 1 cut(s) 75
Hpy188I TCNGA 1 cut(s) 36
Hpy8I GTNNAC 1 cut(s) 75
HpyCH4V TGCA 2 cut(s) 43, 85
HpyF3I CTNAG 2 cut(s) 15, 69
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 1 cut(s) 132
Lsp1109I GCAGC 2 cut(s) 65, 97
MaeI CTAG 1 cut(s) 89
MfeI CAATTG 1 cut(s) 165
MluCI AATT 2 cut(s) 37, 165
MmeI TCCRAC 1 cut(s) 133
MseI TTAA 2 cut(s) 21, 131
MunI CAATTG 1 cut(s) 165
PkrI GCNGC 2 cut(s) 55, 87
PspPI GGNCC 1 cut(s) 153
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SaqAI TTAA 2 cut(s) 21, 131
SatI GCNGC 2 cut(s) 54, 86
Sau96I GGNCC 1 cut(s) 153
SetI ASST 7 cut(s) 21, 58, 90, 94, 108, 117, 176
SgeI CNNG 4 cut(s) 73, 101, 138, 159
SinI GGWCC 1 cut(s) 153
Sse9I AATT 2 cut(s) 37, 165
SsiI CCGC 2 cut(s) 4, 178
SspMI CTAG 1 cut(s) 89
TasI AATT 2 cut(s) 37, 165
Tru1I TTAA 2 cut(s) 21, 131
Tru9I TTAA 2 cut(s) 21, 131
TseI GCWGC 2 cut(s) 53, 85
TspDTI ATGAA 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 153
XapI RAATTY 1 cut(s) 37
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.