Rroxscaffold_3G00268990

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
N/A
Physical Location & Seq
Forward (+)
61956532 .. 61963521
6990 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00268990.1

Sequence Viewer

Length: 318 bp
ATGAGCACCGTTTTTAACGAACCGGATTCACCGGACAAGGCAATAGATCGGTTATCATCGAATGGAAAATTTCTTTGCTGTGCGACTGCACTTGGATTAATCCTCAACAAGCTTACCATCGGAGAAGATAGAAGATCATTCTCCGAGGTCTGCAAGCAATGGTTAAGAGTGGAAAGTCTAAGACGATCATCACTTCGCAGTCGATACAACGACATTCCCCTTGGTATTTCCCTTGGTATTTTGATCAACGAAACTAACAAGACATCATGTGTCTTCCTTCAACCTAAAAATGAGATTTTTGCTAGAGACAATGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.85

Weight (kDa)

8.43

Isoelectric Point (pI)

71.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box_5 PF18511 29 - 63 8.1e-06 F-box
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 68
AgsI TTSAA 1 cut(s) 281
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 300
ApoI RAATTY 1 cut(s) 68
AseI ATTAAT 1 cut(s) 98
AsuHPI GGTGA 1 cut(s) 21
BbsI GAAGAC 1 cut(s) 265
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 1 cut(s) 125
BclI TGATCA 1 cut(s) 243
BcoDI GTCTC 1 cut(s) 300
BfaI CTAG 2 cut(s) 303, 316
BpiI GAAGAC 1 cut(s) 265
BsaJI CCNNGG 3 cut(s) 144, 220, 232
BsaWI WCCGGW 2 cut(s) 22, 31
Bse3DI GCAATG 1 cut(s) 164
BseDI CCNNGG 3 cut(s) 144, 220, 232
BseMI GCAATG 1 cut(s) 164
BsgI GTGCAG 1 cut(s) 72
BsiHKAI GWGCWC 1 cut(s) 8
BsiSI CCGG 2 cut(s) 23, 32
BsmAI GTCTC 1 cut(s) 300
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 4 cut(s) 46, 134, 185, 243
BsrDI GCAATG 1 cut(s) 164
BssECI CCNNGG 3 cut(s) 144, 220, 232
BssMI GATC 4 cut(s) 46, 134, 185, 243
BssT1I CCWWGG 2 cut(s) 220, 232
Bst4CI ACNGT 1 cut(s) 10
BstC8I GCNNGC 1 cut(s) 155
BstDEI CTNAG 1 cut(s) 179
BstKTI GATC 4 cut(s) 49, 137, 188, 246
BstMAI GTCTC 1 cut(s) 300
BstMBI GATC 4 cut(s) 46, 134, 185, 243
BstV2I GAAGAC 1 cut(s) 265
Cac8I GCNNGC 1 cut(s) 155
CviAII CATG 1 cut(s) 267
CviJI RGCY 1 cut(s) 112
CviKI_1 RGCY 1 cut(s) 112
DdeI CTNAG 1 cut(s) 179
DpnI GATC 4 cut(s) 48, 136, 187, 245
DpnII GATC 4 cut(s) 46, 134, 185, 243
Eco130I CCWWGG 2 cut(s) 220, 232
EcoT14I CCWWGG 2 cut(s) 220, 232
ErhI CCWWGG 2 cut(s) 220, 232
FaeI CATG 1 cut(s) 270
FaiI YATR 1 cut(s) 268
FatI CATG 1 cut(s) 266
FbaI TGATCA 1 cut(s) 243
FspBI CTAG 2 cut(s) 303, 316
HapII CCGG 2 cut(s) 23, 32
Hin1II CATG 1 cut(s) 270
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 1 cut(s) 26
HpaII CCGG 2 cut(s) 23, 32
HphI GGTGA 1 cut(s) 21
Hpy188I TCNGA 2 cut(s) 122, 145
HpyAV CCTTC 1 cut(s) 287
HpyCH4III ACNGT 1 cut(s) 10
HpyCH4V TGCA 2 cut(s) 89, 153
HpyF3I CTNAG 1 cut(s) 179
Hsp92II CATG 1 cut(s) 270
Ksp22I TGATCA 1 cut(s) 243
Kzo9I GATC 4 cut(s) 46, 134, 185, 243
LpnPI CCDG 2 cut(s) 36, 45
MaeI CTAG 2 cut(s) 303, 316
MalI GATC 4 cut(s) 48, 136, 187, 245
MboI GATC 4 cut(s) 46, 134, 185, 243
MboII GAAGA 3 cut(s) 137, 144, 265
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 1 cut(s) 68
MnlI CCTC 2 cut(s) 113, 139
MseI TTAA 3 cut(s) 15, 98, 164
MspI CCGG 2 cut(s) 23, 32
NdeII GATC 4 cut(s) 46, 134, 185, 243
NlaIII CATG 1 cut(s) 270
PfeI GAWTC 1 cut(s) 26
PshBI ATTAAT 1 cut(s) 98
SaqAI TTAA 3 cut(s) 15, 98, 164
Sau3AI GATC 4 cut(s) 46, 134, 185, 243
SduI GDGCHC 1 cut(s) 8
SetI ASST 3 cut(s) 114, 150, 286
Sse9I AATT 1 cut(s) 68
SspMI CTAG 2 cut(s) 303, 316
StyI CCWWGG 2 cut(s) 220, 232
TaaI ACNGT 1 cut(s) 10
TaqI TCGA 2 cut(s) 59, 202
TasI AATT 1 cut(s) 68
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 3 cut(s) 15, 98, 164
Tru9I TTAA 3 cut(s) 15, 98, 164
VspI ATTAAT 1 cut(s) 98
XapI RAATTY 1 cut(s) 68
XspI CTAG 2 cut(s) 303, 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.