Rroxscaffold_4G00280960

DNA-binding domain in plant proteins such as APETALA2 and EREBPs

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
N/A
Physical Location & Seq
Forward (+)
3383824 .. 3401479
17656 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00280960.1

Sequence Viewer

Length: 441 bp
ATGAAACTAAATGGCCATAATGGCATAGGTGATAATAATACTTGCTTGCAGGAACATGATGAACAGATTGATGTGGCCTACATTCCAAGATCTGGCATAAAGCCTTCAAAAGTAATTGAAACGCAGAAAGAGATCGACAAGAAACTTGACTACTTGCATTGTTGGTCTTTTGATGAAATATATGGCATTATAACCTATGCCACATATATAAAATCGTATAAGAAATCTACAACATTGCTTGTGAAGCAACACATGGAATTTGAAAAAAATCTGGAAAACTTGGGTGTCTTAAAGATGCAGGGCATGAACTTCATTCTCTGGTCTAATGTCTGTAGGCCTGTAGGCGTTTCAGATATTGCAGAGCTCGAGGCTACGACGGAGCATGACGTCGAATATTATGAGCTATGGGAATTGATCGAGGAGATTGACGACCTTGACTAG

Protein Analysis

146

Amino Acids

16.99

Weight (kDa)

4.69

Isoelectric Point (pI)

36.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 191
AatII GACGTC 1 cut(s) 390
AccB7I CCANNNNNTGG 1 cut(s) 92
AcoI YGGCCR 1 cut(s) 13
AcsI RAATTY 1 cut(s) 257
AcyI GRCGYC 1 cut(s) 387
AfiI CCNNNNNNNGG 1 cut(s) 92
AgsI TTSAA 3 cut(s) 108, 119, 263
AluBI AGCT 2 cut(s) 364, 403
AluI AGCT 2 cut(s) 364, 403
Alw21I GWGCWC 1 cut(s) 366
Ama87I CYCGRG 1 cut(s) 365
AoxI GGCC 3 cut(s) 13, 75, 335
ApoI RAATTY 1 cut(s) 257
AsuHPI GGTGA 1 cut(s) 41
AvaI CYCGRG 1 cut(s) 365
BalI TGGCCA 1 cut(s) 15
BanII GRGCYC 1 cut(s) 366
Bbv12I GWGCWC 1 cut(s) 366
BfaI CTAG 1 cut(s) 439
BfmI CTRYAG 2 cut(s) 331, 339
BglI GCCNNNNNGGC 1 cut(s) 21
BglII AGATCT 1 cut(s) 89
BmeT110I CYCGRG 1 cut(s) 365
BmsI GCATC 1 cut(s) 285
BsaHI GRCGYC 1 cut(s) 387
Bsc4I CCNNNNNNNGG 1 cut(s) 92
Bse3DI GCAATG 1 cut(s) 233
BseLI CCNNNNNNNGG 1 cut(s) 92
BseMI GCAATG 1 cut(s) 233
BseRI GAGGAG 1 cut(s) 434
BshFI GGCC 3 cut(s) 15, 77, 337
BsiHKAI GWGCWC 1 cut(s) 366
BsiHKCI CYCGRG 1 cut(s) 365
BslI CCNNNNNNNGG 1 cut(s) 92
BsnI GGCC 3 cut(s) 15, 77, 337
BsoBI CYCGRG 1 cut(s) 365
Bsp1286I GDGCHC 1 cut(s) 366
Bsp143I GATC 3 cut(s) 89, 132, 414
BspANI GGCC 3 cut(s) 15, 77, 337
BsrDI GCAATG 1 cut(s) 233
BssMI GATC 3 cut(s) 89, 132, 414
BssNI GRCGYC 1 cut(s) 387
BstACI GRCGYC 1 cut(s) 387
BstC8I GCNNGC 1 cut(s) 47
BstKTI GATC 3 cut(s) 92, 135, 417
BstMBI GATC 3 cut(s) 89, 132, 414
BstMWI GCNNNNNNNGC 2 cut(s) 21, 244
BstSFI CTRYAG 2 cut(s) 331, 339
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
BsuRI GGCC 3 cut(s) 15, 77, 337
Cac8I GCNNGC 1 cut(s) 47
CviAII CATG 4 cut(s) 56, 253, 304, 383
CviJI RGCY 7 cut(s) 15, 77, 103, 337, 364, 371, 403
CviKI_1 RGCY 7 cut(s) 15, 77, 103, 337, 364, 371, 403
DpnI GATC 3 cut(s) 91, 134, 416
DpnII GATC 3 cut(s) 89, 132, 414
EaeI YGGCCR 1 cut(s) 13
Ecl136II GAGCTC 1 cut(s) 364
Eco147I AGGCCT 1 cut(s) 337
Eco24I GRGCYC 1 cut(s) 366
Eco53kI GAGCTC 1 cut(s) 364
Eco88I CYCGRG 1 cut(s) 365
EcoICRI GAGCTC 1 cut(s) 364
EcoT38I GRGCYC 1 cut(s) 366
FaeI CATG 4 cut(s) 59, 256, 307, 386
FatI CATG 4 cut(s) 55, 252, 303, 382
FriOI GRGCYC 1 cut(s) 366
FspBI CTAG 1 cut(s) 439
HaeIII GGCC 3 cut(s) 15, 77, 337
Hin1I GRCGYC 1 cut(s) 387
Hin1II CATG 4 cut(s) 59, 256, 307, 386
HphI GGTGA 1 cut(s) 41
Hpy188I TCNGA 1 cut(s) 352
Hpy188III TCNNGA 1 cut(s) 272
Hpy99I CGWCG 2 cut(s) 379, 392
HpyAV CCTTC 1 cut(s) 114
HpyCH4IV ACGT 1 cut(s) 387
HpyCH4V TGCA 4 cut(s) 49, 157, 298, 359
HpyF10VI GCNNNNNNNGC 2 cut(s) 21, 244
HpySE526I ACGT 1 cut(s) 387
Hsp92I GRCGYC 1 cut(s) 387
Hsp92II CATG 4 cut(s) 59, 256, 307, 386
Kzo9I GATC 3 cut(s) 89, 132, 414
LmnI GCTCC 1 cut(s) 379
LpnPI CCDG 6 cut(s) 35, 78, 257, 284, 304, 351
LweI GCATC 1 cut(s) 285
MaeI CTAG 1 cut(s) 439
MaeII ACGT 1 cut(s) 387
MalI GATC 3 cut(s) 91, 134, 416
MboI GATC 3 cut(s) 89, 132, 414
MflI RGATCY 1 cut(s) 89
MhlI GDGCHC 1 cut(s) 366
MlsI TGGCCA 1 cut(s) 15
MluCI AATT 3 cut(s) 114, 257, 410
MluNI TGGCCA 1 cut(s) 15
MnlI CCTC 2 cut(s) 361, 412
Mox20I TGGCCA 1 cut(s) 15
MscI TGGCCA 1 cut(s) 15
MseI TTAA 1 cut(s) 290
Msp20I TGGCCA 1 cut(s) 15
MwoI GCNNNNNNNGC 2 cut(s) 21, 244
NdeII GATC 3 cut(s) 89, 132, 414
NlaIII CATG 4 cut(s) 59, 256, 307, 386
PaeR7I CTCGAG 1 cut(s) 365
PceI AGGCCT 1 cut(s) 337
PflMI CCANNNNNTGG 1 cut(s) 92
PsiI TTATAA 1 cut(s) 191
Psp124BI GAGCTC 1 cut(s) 366
PspXI VCTCGAGB 1 cut(s) 365
PsuI RGATCY 1 cut(s) 89
SacI GAGCTC 1 cut(s) 366
SaqAI TTAA 1 cut(s) 290
Sau3AI GATC 3 cut(s) 89, 132, 414
SduI GDGCHC 1 cut(s) 366
SetI ASST 6 cut(s) 31, 197, 366, 390, 405, 435
SfaNI GCATC 1 cut(s) 285
SfcI CTRYAG 2 cut(s) 331, 339
Sfr274I CTCGAG 1 cut(s) 365
SlaI CTCGAG 1 cut(s) 365
SmlI CTYRAG 1 cut(s) 365
SmoI CTYRAG 1 cut(s) 365
Sse9I AATT 3 cut(s) 114, 257, 410
SseBI AGGCCT 1 cut(s) 337
SspI AATATT 1 cut(s) 395
SspMI CTAG 1 cut(s) 439
SstI GAGCTC 1 cut(s) 366
StuI AGGCCT 1 cut(s) 337
TaiI ACGT 1 cut(s) 390
TaqI TCGA 4 cut(s) 135, 366, 390, 417
TasI AATT 3 cut(s) 114, 257, 410
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TspDTI ATGAA 5 cut(s) 17, 75, 189, 301, 320
TspGWI ACGGA 1 cut(s) 392
Van91I CCANNNNNTGG 1 cut(s) 92
XapI RAATTY 1 cut(s) 257
XhoI CTCGAG 1 cut(s) 365
XspI CTAG 1 cut(s) 439
ZraI GACGTC 1 cut(s) 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.