Rroxscaffold_4G00306780

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
N/A
Physical Location & Seq
Reverse (-)
27745505 .. 27746085
581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00306780.1

Sequence Viewer

Length: 261 bp
ATGAGTACCCAACAGATCAATCCTTATCACGATCCAGATGTTGATGTCATTGGCACAGAGTTTCCAGAATATCAGGTGAAGCCAGGAACATACTATCTCTGTCATGGACCTATAGAATGCAAAAAAGACGAGTATAATGATTGGATCGAAGGAGACATTGAAAAAGAAGAAATCCAGCAGAGGGAGCTTGAGGGGTTGCTTGAAGCAAGAGCAGAAGCAGAAGCAGAACCAAGGCTAGCAATAACTACTGCAATGGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.87

Weight (kDa)

4.25

Isoelectric Point (pI)

52.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 26, 152
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 181
AgsI TTSAA 2 cut(s) 161, 203
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
Alw26I GTCTC 1 cut(s) 147
AlwI GGATC 2 cut(s) 26, 152
AspS9I GGNCC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 88
AsuNHI GCTAGC 1 cut(s) 235
AvaII GGWCC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 84
BcoDI GTCTC 1 cut(s) 147
BfaI CTAG 1 cut(s) 236
BfmI CTRYAG 1 cut(s) 111
Bme1390I CCNGG 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 84
BmtI GCTAGC 1 cut(s) 239
BpuEI CTTGAG 1 cut(s) 209
BsaJI CCNNGG 1 cut(s) 230
Bsc4I CCNNNNNNNGG 1 cut(s) 181
Bse3DI GCAATG 1 cut(s) 258
BseBI CCWGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 230
BseLI CCNNNNNNNGG 1 cut(s) 181
BseMI GCAATG 1 cut(s) 258
BslI CCNNNNNNNGG 1 cut(s) 181
BsmAI GTCTC 1 cut(s) 147
BsmI GAATGC 1 cut(s) 122
Bsp143I GATC 3 cut(s) 15, 31, 144
BspOI GCTAGC 1 cut(s) 239
BspPI GGATC 2 cut(s) 26, 152
BsrDI GCAATG 1 cut(s) 258
BssECI CCNNGG 1 cut(s) 230
BssMI GATC 3 cut(s) 15, 31, 144
BssT1I CCWWGG 1 cut(s) 230
Bst2UI CCWGG 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 237
BstKTI GATC 3 cut(s) 18, 34, 147
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 3 cut(s) 15, 31, 144
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
BstSFI CTRYAG 1 cut(s) 111
Cac8I GCNNGC 1 cut(s) 237
Cfr13I GGNCC 1 cut(s) 107
Csp6I GTAC 1 cut(s) 6
CviAII CATG 1 cut(s) 104
CviJI RGCY 3 cut(s) 82, 187, 235
CviKI_1 RGCY 3 cut(s) 82, 187, 235
CviQI GTAC 1 cut(s) 6
DpnI GATC 3 cut(s) 17, 33, 146
DpnII GATC 3 cut(s) 15, 31, 144
Eco130I CCWWGG 1 cut(s) 230
Eco47I GGWCC 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 230
ErhI CCWWGG 1 cut(s) 230
FaeI CATG 1 cut(s) 107
FaiI YATR 5 cut(s) 91, 105, 113, 135, 259
FatI CATG 1 cut(s) 103
FspBI CTAG 1 cut(s) 236
Hin1II CATG 1 cut(s) 107
HphI GGTGA 1 cut(s) 88
Hpy188III TCNNGA 3 cut(s) 29, 35, 65
HpyAV CCTTC 1 cut(s) 143
HpyCH4V TGCA 2 cut(s) 120, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
Hsp92II CATG 1 cut(s) 107
Kzo9I GATC 3 cut(s) 15, 31, 144
LmnI GCTCC 1 cut(s) 184
LpnPI CCDG 6 cut(s) 48, 59, 69, 78, 96, 188
MaeI CTAG 1 cut(s) 236
MalI GATC 3 cut(s) 17, 33, 146
MboI GATC 3 cut(s) 15, 31, 144
MboII GAAGA 1 cut(s) 179
MnlI CCTC 2 cut(s) 174, 184
MspR9I CCNGG 1 cut(s) 84
Mva1269I GAATGC 1 cut(s) 122
MvaI CCWGG 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 184
NdeII GATC 3 cut(s) 15, 31, 144
NheI GCTAGC 1 cut(s) 235
NlaIII CATG 1 cut(s) 107
PctI GAATGC 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PspPI GGNCC 1 cut(s) 107
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
Sau3AI GATC 3 cut(s) 15, 31, 144
Sau96I GGNCC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 84
SetI ASST 3 cut(s) 78, 112, 189
SfcI CTRYAG 1 cut(s) 111
SinI GGWCC 1 cut(s) 107
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
SspMI CTAG 1 cut(s) 236
StyD4I CCNGG 1 cut(s) 82
StyI CCWWGG 1 cut(s) 230
TaqI TCGA 1 cut(s) 147
VpaK11BI GGWCC 1 cut(s) 107
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.