Rroxscaffold_4G00324770
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
N/A
Physical Location & Seq
Reverse (-)
56416736 .. 56417293
558 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00324770.1

Sequence Viewer

Length: 171 bp
ATGTTCAATGACGGCTTGAATCTTGATAATTTTGTGAAGATAGCTCTCCCTGAAGGTGTTGCAGACATTGCAGATTTGCTTGTCTTCAAGGAGGCGATATCAATGTCGAAGAAATTCACACACAGTTGTATTGTCTACACCGATAGGACAAAAAATTTGAAGTGCAGGTGA

Protein Analysis

56

Amino Acids

6.34

Weight (kDa)

7.79

Isoelectric Point (pI)

12.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 156
Acc36I ACCTGC 1 cut(s) 156
AccI GTMKAC 1 cut(s) 135
AcsI RAATTY 2 cut(s) 113, 154
AcuI CTGAAG 1 cut(s) 72
AgsI TTSAA 4 cut(s) 7, 19, 88, 160
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
ApoI RAATTY 2 cut(s) 113, 154
ArsI GACNNNNNNTTYG 2 cut(s) 139, 171
Asp700I GAANNNNTTC 1 cut(s) 113
BbsI GAAGAC 1 cut(s) 76
BceAI ACGGC 1 cut(s) 28
BfuAI ACCTGC 1 cut(s) 156
BpiI GAAGAC 1 cut(s) 76
Bse3DI GCAATG 1 cut(s) 66
BseMI GCAATG 1 cut(s) 66
BspMI ACCTGC 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 125
BstAPI GCANNNNNTGC 1 cut(s) 68
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstV2I GAAGAC 1 cut(s) 76
BveI ACCTGC 1 cut(s) 156
CviJI RGCY 2 cut(s) 15, 44
CviKI_1 RGCY 2 cut(s) 15, 44
Eco32I GATATC 1 cut(s) 99
Eco57I CTGAAG 1 cut(s) 72
EcoRV GATATC 1 cut(s) 99
FblI GTMKAC 1 cut(s) 135
FspEI CC 8 cut(s) 39, 62, 63, 74, 77, 130, 151, 154
HinfI GANTC 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 136
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4V TGCA 3 cut(s) 62, 71, 165
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
LpnPI CCDG 2 cut(s) 63, 151
MboII GAAGA 3 cut(s) 49, 76, 121
MluCI AATT 3 cut(s) 28, 113, 154
MnlI CCTC 1 cut(s) 85
MroXI GAANNNNTTC 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 68
PaqCI CACCTGC 1 cut(s) 156
PdmI GAANNNNTTC 1 cut(s) 113
PfeI GAWTC 1 cut(s) 19
SetI ASST 3 cut(s) 46, 58, 170
SgeI CNNG 5 cut(s) 28, 35, 62, 92, 100
Sse9I AATT 3 cut(s) 28, 113, 154
TaaI ACNGT 1 cut(s) 125
TaqI TCGA 1 cut(s) 107
TasI AATT 3 cut(s) 28, 113, 154
TfiI GAWTC 1 cut(s) 19
XapI RAATTY 2 cut(s) 113, 154
XmiI GTMKAC 1 cut(s) 135
XmnI GAANNNNTTC 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.