Rroxscaffold_4G00325800

Receptor-like protein 2

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
N/A
Physical Location & Seq
Reverse (-)
57710966 .. 57717356
6391 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00325800.1

Sequence Viewer

Length: 534 bp
ATGGCTCAAATGAAAGCCCAAACCAAATTGGAAAAGGAAATAAAGATAGCTCACAAACCAAATATTCCTCGTGCTGATTACAATTACCTCAAATTATTGCCAGAAGATATTTATAATACTACCATACTTGAAGACATTTCACTAGCTTGGAATTCATTATATGATGTCATTAATGATGAAATTGTCAACCTGACTAACCTTACAATCCTCGACCTCTACTATAACCAATTTACTGGCATCCTCCCTAGCTTTGATTTATTGCTCGAACTTTGTAGAATTTCACTTTGTCAACTTAGTGAAGGTGACATTCAGAAAAATAACTTCTCTGGTATCTTACCAAGAAGGCTATACTCGTGCAAGTCCTTGAAAGCAATTCGATTGAGCTATAATAATCTAGCGGTTCAATTAAATCCTGAAATTCTTTGCTTGAAATACTTGTTCTTCCTCTCACTTGGTTGGAACAAACGTTTAACCAATGTGACAGGGGCAACTGATGGGTTGCAAACATCTCATAATCCTTTCTTTGGCATCTAG

Protein Analysis

177

Amino Acids

20.31

Weight (kDa)

6.72

Isoelectric Point (pI)

36.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 114
AciI CCGC 1 cut(s) 398
AclI AACGTT 1 cut(s) 466
AcsI RAATTY 3 cut(s) 151, 276, 417
AfiI CCNNNNNNNGG 1 cut(s) 524
AgsI TTSAA 4 cut(s) 131, 367, 404, 430
AluBI AGCT 4 cut(s) 50, 146, 249, 384
AluI AGCT 4 cut(s) 50, 146, 249, 384
ApoI RAATTY 3 cut(s) 151, 276, 417
AseI ATTAAT 1 cut(s) 171
AsuHPI GGTGA 1 cut(s) 314
BauI CACGAG 2 cut(s) 69, 352
BbsI GAAGAC 1 cut(s) 138
BccI CCATC 1 cut(s) 488
BfaI CTAG 4 cut(s) 143, 246, 395, 532
BmsI GCATC 1 cut(s) 246
BpiI GAAGAC 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 524
Bse1I ACTGG 1 cut(s) 238
BseGI GGATG 1 cut(s) 237
BseLI CCNNNNNNNGG 1 cut(s) 524
BseNI ACTGG 1 cut(s) 238
BslI CCNNNNNNNGG 1 cut(s) 524
BspACI CCGC 1 cut(s) 398
BsrI ACTGG 1 cut(s) 238
BssSI CACGAG 2 cut(s) 69, 352
Bst2BI CACGAG 2 cut(s) 69, 352
BstDEI CTNAG 1 cut(s) 293
BstF5I GGATG 1 cut(s) 237
BstV2I GAAGAC 1 cut(s) 138
BstXI CCANNNNNNTGG 1 cut(s) 233
BtsCI GGATG 1 cut(s) 237
CviJI RGCY 7 cut(s) 5, 17, 50, 146, 249, 346, 384
CviKI_1 RGCY 7 cut(s) 5, 17, 50, 146, 249, 346, 384
DdeI CTNAG 1 cut(s) 293
EcoRI GAATTC 1 cut(s) 151
FaiI YATR 8 cut(s) 114, 125, 160, 162, 222, 349, 387, 513
FokI GGATG 1 cut(s) 224
FspBI CTAG 4 cut(s) 143, 246, 395, 532
HincII GTYRAC 2 cut(s) 187, 290
HindII GTYRAC 2 cut(s) 187, 290
HphI GGTGA 1 cut(s) 314
Hpy166II GTNNAC 2 cut(s) 187, 290
Hpy188I TCNGA 1 cut(s) 312
Hpy188III TCNNGA 1 cut(s) 413
Hpy8I GTNNAC 2 cut(s) 187, 290
HpyAV CCTTC 2 cut(s) 293, 336
HpyCH4IV ACGT 1 cut(s) 466
HpyCH4V TGCA 2 cut(s) 357, 502
HpyF3I CTNAG 1 cut(s) 293
HpySE526I ACGT 1 cut(s) 466
LpnPI CCDG 6 cut(s) 114, 203, 219, 312, 426, 468
LweI GCATC 1 cut(s) 246
MaeI CTAG 4 cut(s) 143, 246, 395, 532
MaeII ACGT 1 cut(s) 466
MaeIII GTNAC 2 cut(s) 302, 478
MboII GAAGA 3 cut(s) 116, 143, 433
MmeI TCCRAC 1 cut(s) 437
MnlI CCTC 6 cut(s) 78, 98, 218, 224, 251, 455
MseI TTAA 3 cut(s) 171, 407, 470
NmuCI GTSAC 2 cut(s) 302, 478
PshBI ATTAAT 1 cut(s) 171
PsiI TTATAA 1 cut(s) 114
Psp1406I AACGTT 1 cut(s) 466
SaqAI TTAA 3 cut(s) 171, 407, 470
SfaNI GCATC 1 cut(s) 246
SsiI CCGC 1 cut(s) 398
SspI AATATT 1 cut(s) 64
SspMI CTAG 4 cut(s) 143, 246, 395, 532
TaiI ACGT 1 cut(s) 469
TaqI TCGA 3 cut(s) 210, 264, 376
Tru1I TTAA 3 cut(s) 171, 407, 470
Tru9I TTAA 3 cut(s) 171, 407, 470
TseFI GTSAC 2 cut(s) 302, 478
Tsp45I GTSAC 2 cut(s) 302, 478
TspDTI ATGAA 3 cut(s) 26, 144, 192
VspI ATTAAT 1 cut(s) 171
XapI RAATTY 3 cut(s) 151, 276, 417
XspI CTAG 4 cut(s) 143, 246, 395, 532
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.